We narrowed to 25,286 results for: expression vector
-
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVTagsExpressionMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-NLSlacZ-stop-L2
Plasmid#186358PurposeEntry clone with ORF encoding NLS lacZ flanked by Gateway recombination sequences.DepositorInsertlacZ (lacZ Synthetic, E. coli)
UseExpression of nuclear lacz reporterTagsNuclear localization signalExpressionMutationPromoterAvailable sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_CV2
Plasmid#167165PurposepgRNA_CV2 is derived from gRNA_cloning vector (Addgene plasmid ID: 41824) by adding about 80 bps from the sgRNA sequence as well as an AgeI site. In the literature, sgRNA_AL is used as an alias.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterU6 promoterAvailable sinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX_307
Plasmid#41392PurposeConstitutive lentiviral expression, SV40-puro; EF1a-gateway-V5 tagDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral; Gateway destination vectorTagsV5ExpressionMammalianMutationPromoterEF1aAvailable sinceNov. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ H2B-mTagBFP2
Plasmid#99267PurposeContains a fusion of human histone H2B to fluorescent protein mTagBFP2 in the pCS2+ expression vector. It has the SP6 RNA polymerase site for in vitro transcription.DepositorInsertmTagBFP2-3XHA
UseTagsH2BExpressionMammalianMutationPromoterSP6Available sinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNIC28-Bsa4-TF
Plasmid#61689PurposeE. coli expression vector based on pNIC28-Bsa4 (addgene #26103) with the TEE and trigger factor sequences insertedDepositorTypeEmpty backboneUseTagsHIS and Trigger FactorExpressionBacterialMutationPromoterT7Available sinceMarch 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMCMV3
Plasmid#85711PurposeExpression vector employing the mouse CMV major immediate-early promoter enhancer (MIEP); there is a small polylinker (PstI, SmaI, XbaI, SalI ,HpaI) followed by the SV40 polyA signal sequencesDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterMIEPmouse CMV MIEPAvailable sinceApril 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-IL-2signal-6xMyc
Plasmid#128033PurposeMammalian expression vector with N terminal IL-2 signal peptide and 6xMyc tagDepositorTypeEmpty backboneUseTags6xMyc and IL-2 signal peptideExpressionMammalianMutationPromoterAvailable sinceAug. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-NLS
Plasmid#82518PurposeLentivirus vector. Expresses Halotag proteins with nuclear localization signal in mammalian cells.DepositorInsertNuclear localizaition sequence
UseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRII-BbsI-sgRNAscaffold
Plasmid#159352PurposeExpression vector for a customizable guide RNADepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
BII-Sh-BnTW
Plasmid#133365PurposePiggybac vector for shRNA-mediated knockdown, with co-expression with tdTomato-NLSDepositorInserttdTomato-NLS
UseTagsFlag-tagged tdTomatoExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free)Available sinceJan. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ H2B-Katushka2
Plasmid#99266PurposeContains a fusion of human histone H2B to fluorescent protein Katushka2 in the pCS2+ expression vector. It has the SP6 RNA polymerase site for in vitro transcription.DepositorInsertKatushka2-3XHA
UseTagsH2BExpressionMammalianMutationPromoterSP6Available sinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
FUW-hTie1-FLAG
Plasmid#119233PurposePlasmid encodes FLAG-tagged full-length human Tie1 gene cloned in lentiviral vector.DepositorInsertTIE1 (TIE1 Human)
UseLentiviralTagsFLAGExpressionMutationPromoterP hUbCAvailable sinceDec. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPICZa-STE2-1D4
Plasmid#133436PurposeMutant form of yeast STE2 coding sequence in vector for inducible expression in the methanogenic yeast Pichia pastoris.DepositorInsertSTE2 (STE2 Budding Yeast)
UseTagsExpressionBacterialMutationC59S/C252APromoterAvailable sinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ H2B-mCerulean
Plasmid#99268PurposeContains a fusion of human histone H2B to fluorescent protein mCerulean in the pCS2+ expression vector. It has the SP6 RNA polymerase site for in vitro transcriptionDepositorInsertmCerulean-3XFLAG
UseTagsH2BExpressionMammalianMutationPromoterSP6Available sinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 IL-2 signal mFc
Plasmid#128042PurposeMammalian expression vector with C terminal IL-2 signal peptide and mFcDepositorTypeEmpty backboneUseTagsIL-2 signal peptide and mFcExpressionMammalianMutationPromoterAvailable sinceAug. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPICZac-STE2-1D4
Plasmid#133437PurposeMutant yeast STE2 coding sequence in vector for inducible expression in the methanogenic yeast Pichia pastoris.DepositorInsertSTE2 (STE2 Budding Yeast)
UseTagsExpressionYeastMutationC59S/C252APromoterAvailable sinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAttB-Tub
Plasmid#203966PurposeFly transformation vector with Tubulin promoter and SV40 PA site and a UTR for ubiquitous expressionDepositorTypeEmpty backboneUseTagsExpressionInsectMutationPromoterAvailable sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ H2B-mRuby2
Plasmid#99270PurposeContains a fusion of human histone H2B to fluorescent protein mRuby2 in the pCS2+ expression vector. It has the SP6 RNA polymerase site for in vitro transcription.DepositorInsertmRuby2-3XHA
UseTagsH2BExpressionMammalianMutationPromoterSP6Available sinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK2-miR-200b-3p
Plasmid#135694PurposeMammalian expression vector, Luciferase reporter to test activity of miRNA (miR-200b)DepositorInsertmiR-200b from human PTEN 3'UTR
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only