We narrowed to 24,235 results for: c-MYC

#239974

PiggyBac plasmid for inducible PEmax expression and Puromycin selection

Jay Shendure

Chen et al Nature. 2024 Aug;632(8027):1073-1081. do

June 26, 2025

Academic Institutions and Nonprofits only

#164464

Localization of mGreenLantern fluorescent protein to histone 2B

Gregory Petsko

Campbell et al Proc Natl Acad Sci U S A. 2020 Dec 1;117

Jan. 20, 2021

Academic Institutions and Nonprofits only

#155121

Tol2 vector for skeletal-muscle expression of QFGal4. Contains cmlc2:mRFP-SV40pA transgenesis marker

Bret Pearson

Burgess et al Dev Biol. 2020 Jul 19. pii: S0012-1606(2

Sept. 15, 2020

Academic Institutions and Nonprofits only

#113716

Lentiviral vector for fluorescent reporter system: expresses a green fluorescent protein that is preceded by an inactive version of a red fluorescent protein (2 ntd substitution at the fluorophore)

Gerald Schwank

Savic et al Elife. 2018 May 29;7. pii: 33761. doi: 1

Aug. 23, 2018

Academic Institutions and Nonprofits only

#232891

Plasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.

Jolanda Van Leeuwen

Batte et al Cell Syst. 2026 Mar 2:101515. doi: 10.10

April 30, 2025

Academic Institutions and Nonprofits only

#232895

Plasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.

Jolanda Van Leeuwen

Batte et al Cell Syst. 2026 Mar 2:101515. doi: 10.10

April 30, 2025

Academic Institutions and Nonprofits only

#232888

Plasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.

Jolanda Van Leeuwen

Batte et al Cell Syst. 2026 Mar 2:101515. doi: 10.10

March 11, 2025

Academic Institutions and Nonprofits only

#232884

Plasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.

Jolanda Van Leeuwen

Batte et al Cell Syst. 2026 Mar 2:101515. doi: 10.10

Feb. 26, 2025

Academic Institutions and Nonprofits only

#232894

Plasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.

Jolanda Van Leeuwen

Batte et al Cell Syst. 2026 Mar 2:101515. doi: 10.10

Feb. 26, 2025

Academic Institutions and Nonprofits only