We narrowed to 7,655 results for: PAC
-
Plasmid#209322PurposeAAV packaging vector containing a APOBEC1-YTH expression, a P2A-EGFP expression cassette,.DepositorInsertAPOBEC1-YTH-HA
UseAAVTagsHAAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-EGFP-APOBEC1-YTH
Plasmid#209319PurposeAAV packaging vector containing a EGFP-P2A expression cassette, APOBEC1-YTH cassette.DepositorInsertAPOBEC1-YTH-HA
UseAAVTagsHAAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
SiRES COR1C DCC-GFP
Plasmid#195149Purposeimage COR1CDepositorInsertCORO1C (CORO1C Human)
ExpressionMammalianMutationmutations to make si RNA resistant and remove coi…Available SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
SiRES COR1C ACT--GFP
Plasmid#195151Purposeimage COR1CDepositorInsertCORO1C (CORO1C Human)
ExpressionMammalianMutationmutations to make si RNA resistant and remove act…Available SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCitro-15a
Plasmid#202033Purposep15a-based plasmid that encodes a conjugative system synthesized from metagenomic data for conjugation to CitrobacterDepositorInsertconjugative system from a Citrobacter spp.
UseSynthetic BiologyAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpG-DmXRN1_1323-1355_P
Plasmid#147245PurposeBacterial Expression of DmXRN1_1323-1355DepositorInsertDmXRN1_1323-1355 (pcm Fly)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR2_motif_scram
Plasmid#149397PurposeP. aeruginosa PA14 CRISPR2 locus, with a scrambled Upstream recognition motifDepositorInsertPseudomonas aeruginosa PA14 CRISPR2 locus
ExpressionBacterialMutationUpstream motif recognized by Cas1-2/3 during spac…PromoterpBADAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NLS-QPAS1-VP16
Plasmid#186187PurposeAAV vector packaging QPAS1-VP16, a component of optogenetic system for NIR light-controllable transcriptional activationDepositorInsertNLS-QPAS1-VP16
UseAAVPromoterCAGAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSN526
Plasmid#184827PurposeExpresses human KIF5A(∆exon27) in insect cellsDepositorInsertKIF5A (∆exon27) (KIF5A Human)
TagsmScarlet-2xStrepIIExpressionInsectMutation∆exon27 form of human KIF5APromoterpolyhedrinAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcry:mCherry,-600unc:cct3GFP
Plasmid#172528PurposealphaA-crystallin promoter (cry) drives mCherry expression in the lens. The 600bp unc-45b muscle-specific promoter drives expression of GFP-tagged zebrafish cct3.DepositorInsertcct3-GFP
ExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1-Xlrbpa-dsRBD(+6)
Plasmid#171548PurposeEncoding part of the Xenopus Xlrbpa-2 protein from M120 to L202DepositorInsertXlrbpa (prkra.L Frog)
ExpressionBacterialMutationa six amino acid_TRLTEG_insertion in the L1 regionAvailable SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
E1_pENTR_L1-L4_NI_G1333-DddtoxA-C
Plasmid#171724PurposeptpTALECD vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC- and N-termini of TALEN, half of cytidine deaminase domain of dddA of Burkholderia cenocepacia, uracil glycosylase inhibitor
UseMultisite gateway entry vectorAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
E1_pENTR_L1-L4_NN_G1333-DddtoxA-C
Plasmid#171728PurposeptpTALECD vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC- and N-termini of TALEN, half of a cytidine deaminase domain of dddA of Burkholderia cenocepacia, uracil glycosylase inhibitor
UseMultisite gateway entry vectorAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
E3_pENTR_L3-L2_NG_G1333-DddtoxA-C
Plasmid#171732PurposeptpTALECD vector assembly, Entry clone 1 with attL2 and L3DepositorInsertC- and N-termini of TALEN, half of cytidine deaminase domain of dddA of Burkholderia cenocepacia, uracil glycosylase inhibitor
UseMultisite gateway entry vectorAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
E1_pENTR_L1-L4_NI_G1333-DddtoxA-N
Plasmid#171725PurposeptpTALECD vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC- and N-termini of TALEN, half of cytidine deaminase domain of dddA of Burkholderia cenocepacia, uracil glycosylase inhibitor
UseMultisite gateway entry vectorAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
E1_pENTR_L1-L4_NN_G1333-DddtoxA-N
Plasmid#171729PurposeptpTALECD vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC- and N-termini of TALEN, half of cytidine deaminase domain of dddA of Burkholderia cenocepacia, uracil glycosylase inhibitor
UseMultisite gateway entry vectorAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
E3_pENTR_L3-L2_NG_G1333-DddtoxA-N
Plasmid#171733PurposeptpTALECD vector assembly, Entry clone 1 with attL2 and L3DepositorInsertC- and N-termini of TALEN, half of cytidine deaminase domain of dddA of Burkholderia cenocepacia, uracil glycosylase inhibitor
UseMultisite gateway entry vectorAvailable SinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
GLN, Linear-3, PolyU(1), Hairpin Distance = 0nt
Plasmid#166986PurposeTests for the impact of 1 uracil in conjunction with a hairpin structure in a poly-uracil tract on human polymerase III transcription from a GLN tRNA promoter.DepositorInsertTermination module:PolyU(1), Hairpin = 0 nt
ExpressionMammalianAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
GLY, Linear-3, PolyU(4), Hairpin Distance = 0nt
Plasmid#166991PurposeTests for the impact of 4 uracil in conjunction with a hairpin structure in a poly-uracil tract on human polymerase III transcription from a GLY tRNA promoter.DepositorInsertTermination module:PolyU(4), Hairpin = 0 nt
ExpressionMammalianAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only