We narrowed to 19,347 results for: EGFP
-
Plasmid#216161PurposeContains a Golden-Gate cloning cassette to express up to four gRNA and EGFPDepositorTypeEmpty backboneUseLentiviralAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
pEGFP-RNF138-delta 18-58
Plasmid#78921PurposeMammalian expression of RNF138 with delta 18-58 and an EGFP fusionDepositorAvailable sinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpCas9(LWKYQS)-P2A-EGFP (BKS1014)
Plasmid#223127PurposepCMV and pT7 Human expression plasmid for TadCBEd using SpCas9 CBE enzyme with LWKYQS amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadA-CDd-SpCas9(LWKYQS)-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpCas9(D10A/LWKYQS)=D1135L, …PromoterCMV and T7Available sinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
CBS-3616
Plasmid#255704PurposeControl plasmid with no GFPDepositorInsertPlasmid with recA promoter without GFP gene
ExpressionBacterialMutationN/APromoterrecAAvailable sinceAug. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
CBS-3611
Plasmid#255703PurposeExpression of GFP under recA promoterDepositorInsertGFP expressing plasmid under recA promoter
ExpressionBacterialMutationN/APromoterrecAAvailable sinceAug. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pICSL50062
Plasmid#245617PurposeLevel 0 Golden Gate part C-Terminal Tag with overhangs TTCG - GCTTDepositorInsertC-Terminal tag eGFP + 6xHA
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable sinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL50044
Plasmid#245602PurposeLevel 0 Golden Gate part C-Terminal Tag with overhangs TTCG - GCTTDepositorInsertC-Terminal tag Monomeric eGFP (mEGFP)
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable sinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL30032
Plasmid#245542PurposeLevel 0 Golden Gate part N-Terminal Tag with overhangs CCAT - AATGDepositorInsertN-Terminal tag Monomeric eGFP (mEGFP)
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable sinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL30013
Plasmid#245533PurposeLevel 0 Golden Gate part N-Terminal Tag with overhangs CCAT - AATGDepositorInsertN-Terminal tag GFP Binding Protein
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable sinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-CDK1-HA
Plasmid#247438PurposeHA-tagged mouse CDK1 cloned into the pCW backbone (Addgene #41393, with puromycin resistance) together with an IRES GFP to indicate doxycycline-inducible expression by fluorescence.DepositorAvailable sinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPMS-2208
Plasmid#232289PurposeUsed for staining GFPDepositorInsertanti GFP DARPin fused to rabbit Fc
ExpressionMammalianMutationWTAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNY-346
Plasmid#231046PurposeUsed for staining GFPDepositorInsertanti GFP DARPin fused to human Fc
UseAffinity Reagent/ AntibodyExpressionMammalianAvailable sinceJan. 17, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSMART-HCKan-yibDp-roGFP2
Plasmid#202462PurposeExpresses redox sensitive GFP (roGFP) after phosphate depletionDepositorInsertreduction-oxidation sensitive green fluorescent protein
ExpressionBacterialPromoteryibDpAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAC3-N-GFP-NES
Plasmid#222606PurposeExpression of MAC3-tagged GFP-NES (N-terminal)DepositorInsertEGFP and 3' nuclear exclusion sequence (NES)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable sinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-N-GFP-NLS
Plasmid#222607PurposeExpression of MAC3-tagged GFP-NLS (N-terminal)DepositorInsertEGFP and 3' nuclear localizaition sequence (NLS)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable sinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-C-GFP-NES
Plasmid#222603PurposeExpression of MAC3-tagged GFP-NES (C-terminal)DepositorInsertEGFP and 5' nuclear exclusion sequence (NES)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable sinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUt-mNF-GFP
Plasmid#199220PurposeLPUtopia-7 matching RMCE donor plasmid with GFP Negative-Feedback circuit (mNF-GFP). Use BlastR for positive selection and HSV-TK for negative selection.DepositorInserthTetR::P2A::EGFP
TagsEGFPExpressionMammalianPromoterCMV D2ir promoterAvailable sinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1
Plasmid#190902PurposeAAV vector expressing thew GFP reporter gene and human sgHTTDepositorAvailable sinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
LV TRE-GFP-TMD-DLL1-Nbox-mutant
Plasmid#194937PurposeLV construct encoding a mutated GFP-TMD-DLL1 ligand containing an ablated Nbox site under dox-inducible TRE promoter and containing a PGK-rtTA-M2-IRES-Puro regulator/resistance marker cassette.DepositorInserteGFP-(PDGFR)TMD-rDLL1 ICD-Nbox-AlaX3-mutant
UseLentiviralAvailable sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only