We narrowed to 76,952 results for: Rest
-
Plasmid#242702PurposeshRNA knockdown human ATF4 geneDepositorInsertATF4 (ATF4 Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shCHAC1 #2
Plasmid#242701PurposeshRNA knockdown human CHAC1 geneDepositorInsertCHAC1 (CHAC1 Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Piggybac-omp25-GFP
Plasmid#246221PurposeExpression of OMP25-GFPDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
NPY td-tomato
Plasmid#245036PurposeSecretory granule marker for endocrine cellsDepositorAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNoRBP.iGlucoSnFR2
Plasmid#244104PurposeBacterial expression of green glucose sensorDepositorInsertiGlucoSnFR2
ExpressionBacterialAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc FLAG-kin-mec3-pRSFDuet
Plasmid#240741PurposeOver-express Sc FLAG-PKA kinase motif-mec3 in E. coliDepositorInsertFLAG-kin-mec3 (MEC3 Budding Yeast)
Tags3X FLAG followed by PKA kinase motifExpressionBacterialAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc hk/P-RFA3-pCDFDuet
Plasmid#240743PurposeOver-express his(10)-PKA kinase motif-PreScission protease site-Sc RFA3 in E. coliDepositorInserthk/P-RFA3 (RFA3 Budding Yeast)
TagsHis(10) followed by PKA kinase motif follwed by P…ExpressionBacterialAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc mec1-S6-P/FLAG-pRS403/GAL-L
Plasmid#240737PurposeOver-express Sc mec1-S6-PreScission Protease Site-FLAG in yeast (integrated)DepositorInsertmec1-S6-P/FLAG (MEC1 Budding Yeast)
TagsS6, followed by PreScission Protease site, follow…ExpressionYeastAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2 GATD1 Alu_Mut2
Plasmid#205471PurposeLuciferase reporter for Alu Domain ActivityDepositorInsertMutant 2 GATD1 Alu Domain
UseLuciferase and RNAiMutationMutated the arms of the alu domain by adding ACAC…PromoterT7Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc [Pol31 + Pol32]-pRS403/GAL
Plasmid#239199PurposeOvererxpress Sc Pol31 & Pol32 when integrated into yeast (S. cer)DepositorAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ec holA(Y316A)-FLAG-pET(11a)(ACH-)
Plasmid#238346Purposeover-expresses C-terminal FLAG tagged E. coli delta (Y316A) in E. coliDepositorInsertC-terminal FLAG tagged E. coli delta (Y316A) (holA E. coli)
Tags3X FLAGExpressionBacterialMutationY316AAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG Lenti CMV EGFP-HA Puro
Plasmid#236082PurposeLentiviral backbone expressing C-terminally HA tagged EGFP, control for empty backbone 236080DepositorInsertEGFP
UseLentiviralTagsHAPromoterCMVAvailable SinceApril 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-Ef1a-Con/Fon-Synaptophysin-10xMyc-WPRE
Plasmid#237446PurposeIntersectional expression of Myc-tagged synaptophysin in the presence of Cre and FlpDepositorInsertCon/Fon-Synaptophysin-10xMyc
UseAAVExpressionMammalianPromoterEF1aAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ec holB-pET(11a)(ACH-)
Plasmid#237234Purposeover-express E. coli holB (Pol III delta prime subunit)DepositorInsertholB (delta prime) (holB E. coli)
ExpressionBacterialAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynI-EGFP-WPRE-hGH poly(A) (Alex_02)
Plasmid#71651PurposeAAV expression of EGFP in human and mouse neuronsDepositorInsertEGFP
UseAAVExpressionMammalianAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-FRT-MCS-WPRE-SV40 - GCH27
Plasmid#230828PurposeAAV cloning vector for Flpo-dependent expression under the TRE promoter.DepositorTypeEmpty backboneUseAAV; Cloning vector, flp/frtAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG Retro EGFP Puro
Plasmid#234463PurposeControl retroviral vector expressing Green Fluorescent Protein. Puromycin selection.DepositorInsertGreen Fluorescent Protein
UseRetroviralAvailable SinceMarch 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAG Retro EGFP Hygro
Plasmid#234462PurposeControl retroviral vector expressing Green Fluorescent Protein. Hygromycin selection.DepositorInsertGreen Fluorescent Protein
UseRetroviralAvailable SinceMarch 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_THADA_pos1toneg0
Plasmid#232388PurposeTHADA enhancer, one sensitizing element made into buffering CoordinatorDepositorInsertTHADA (THADA Human)
UseLuciferaseMutationTHADA enhancer, one sensitizing element made into…Available SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_MSR1_bothneg0scramble
Plasmid#232383PurposeMSR1 enhancer, both buffering Coordinators scrambledDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_FAM153CP_SOX9rep
Plasmid#232400PurposeEnhancer near FAM153CP, buffering element replaced with SOX9 siteDepositorInsertFAM153CP (FAM153CP Human)
UseLuciferaseMutationEnhancer near FAM153CP, buffering element replace…Available SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only