We narrowed to 7,193 results for: gan
-
Plasmid#180352Purposemammalian co-expression of human SEPT9_i3 fused to GFP10 and of human SEPT9_i3 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pTRIP TRE BI_GFP10-14-SEPT7 Gmut2_GFP11-14-SEPT7 Gmut2
Plasmid#180353Purposemammalian co-expression of human SEPT7 Gmut2 fused to GFP10 and of human SEPT7 Gmut2 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 H279DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_SEPT9_i1-14-GFP10_GFP11-14-SEPT7 Gmut2
Plasmid#180359Purposemammalian co-expression of human SEPT9_i1 fused to GFP10 and of human SEPT7 Gmut2 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 H279DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_SEPT9_i3-14-GFP10_GFP11-14-SEPT7 Gmut2
Plasmid#180361Purposemammalian co-expression of human SEPT9_i3 fused to GFP10 and of human SEPT7 Gmut2 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 H279DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_MRN1
Plasmid#103858PurposeHeterologous, cobalt-inducible expression of SQE1 and MRN1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertmarneral synthase 1 (MRN1 Mustard Weed)
UseSynthetic BiologyExpressionBacterialMutationinserted genes are codon optimized2nd amino acid …PromoterPcoaT (from Synechocystis sp. PCC 6803)Available SinceFeb. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_CAS1
Plasmid#103856PurposeHeterologous, cobalt-inducible expression of SQE1 and CAS1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertcycloartenol synthase 1 (CAS1 Mustard Weed)
UseSynthetic BiologyExpressionBacterialMutationinserted genes are codon optimized. 2nd amino aci…PromoterPcoaT (from Synechocystis sp. PCC 6803)Available SinceJan. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSH-hPXR-LBD-K277Q
Plasmid#41620DepositorInserthPXR-LBD-K277Q (NR1I2 Human)
ExpressionMammalianMutationcontains human PXR ligand binding domain (LBD, aa…PromoterpEN1 (chimeric HIV-1 LTR enhancer and HTLV-I LTR …Available SinceMay 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
PBCV-1 Lig-N-HiBiT
Plasmid#215439PurposeBacterially expressed PBCV Lig-N-HiBiT for Ni-NTA purificationDepositorInsertParamecium bursaria Chlorella virus 1 ATP-dependent DNA ligase, N-HiBiT tag, N-10XHis.Thrombin tag
Tags10xHis-tag with thrombin site and HiBiT TagExpressionBacterialMutationCodon Optimized for bacterial expression, T7 gene…PromoterT7 PromotorAvailable SinceJune 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
PBCV-1 Lig-C-HiBiT
Plasmid#215440PurposeBacterially expressed PBCV Lig-C-HiBiT for Ni-NTA purificationDepositorInsertParamecium bursaria Chlorella virus 1 ATP-dependent DNA ligase, C-HiBiT tag, C-10XHis.Thrombin tag
Tags10xHis-tag with thrombin site and HiBiT TagExpressionBacterialMutationCodon Optimized for bacterial expression, T7 gene…PromoterT7 PromotorAvailable SinceJune 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCI AscI MR1 R9H res
Plasmid#214753Purposeexpresses human MR1 R9H resistant to CRISPR editing with a specific sgRNA in mammalian cellsDepositorInsertMHC class I-related protein 1 (MR1 Human)
TagsIRES eGFPExpressionMammalianMutationsilent mutations to prevent editing by CRISPR/Cas…PromoterCMVAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_GFP11-14-SEPT7 Gmut1_GFP10-14-SEPT7 Gmut1
Plasmid#180354Purposemammalian co-expression of human SEPT7 Gmut1 fused to GFP10 and of human SEPT7 Gmut1 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 W269A, H279DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_GFP11-14-SEPT7 Gmut1_SEPT9_i1 Gmut-14-GFP10
Plasmid#180355Purposemammalian co-expression of human SEPT9_i1 Gmut fused to GFP10 and of human SEPT7 Gmut1 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 W269A, H279D and SEPT9_i1 W520A, H530DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_GFP11-14-SEPT7 Gmut1_SEPT9_i3 Gmut-14-GFP10
Plasmid#180356Purposemammalian co-expression of human SEPT9_i3 Gmut fused to GFP10 and of human SEPT7 Gmut1 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 W269A, H279D and SEPT9_i3 W502A, H512DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_SEPT9_i3 NCmut-14-GFP11_SEPT9_i3 NCmut-14-GFP10
Plasmid#180360Purposemammalian co-expression of human SEPT9_i3 NCmut fused to GFP10 and of human SEPT9_i3 NCmut fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT9_i3 I263D, M270DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-L-SA-2A-PuroR-GFP-KRASG12V-TRE-HA-R
Plasmid#258167PurposeDNA template for insertion of doxycycline inducible GFP-KRAS-G12V cassette into the human AAVS1 siteDepositorInsertGFP-KRAS-G12V (KRAS Human, Aequorea victoria)
ExpressionMammalianMutationKRAS G12VPromoterTREAvailable SinceJuly 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
ptE1347D
Plasmid#248055PurposePlant organelle-genome-specific random C-to-T mutagenesisDepositorInsertArabidopsis thaliana RPS5A promoter
ExpressionPlantMutationE1347D mutation in cytidine deaminase domain, low…Available SinceJune 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
mtE1347D
Plasmid#248057PurposePlant organelle-genome-specific random C-to-T mutagenesisDepositorInsertArabidopsis thaliana RPS5A promoter
ExpressionPlantMutationE1347D mutation in cytidine deaminase domain, low…Available SinceJune 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAVS-NDi-H1.2_Khalf-Halo
Plasmid#247485PurposeExpresses H1.2 (Khalf) by tet-on systemDepositorInsertH1.2 (H1-2 Human)
TagsHaloTagExpressionMammalianMutationHalf of Lysine in C-terminal IDR are replaced by …PromoterTet-responsive elementAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
KL095 - pTRE3G-Flag-Halo-CTCF_ZF1_mutant-BGHpA-CAGGS-rtta3G-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt TIGRE donor
Plasmid#232931PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible Flag-Halo-mCTCF ZF1 mutant, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycin selection.DepositorInsertFlag-Halo-CTCF ZF1 deletion mutant
UseMouse TargetingExpressionMammalianMutationDeleted amino acids 264-277Available SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only