We narrowed to 16,181 results for: nes
-
Plasmid#171058PurposeExpresses tandem mClover2-mRuby2 FRET pair with a crowdedness-sensitve linker domain to sense cytosolic crowdedness.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCrowdedness-sensitive linker domain
TagsmClover2 and mRuby2ExpressionMammalianPromoterCMVAvailable sinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-tRNA-Loop2-8A8G
Plasmid#157986PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (tRNA-Loop2-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mCherry-MKLP1
Plasmid#140562PurposeExpresses mCherry tagged MKLP1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMKLP1 (KIF23 Human)
Tags2xmCherryExpressionMammalianPromoterCMV IE94Available sinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
Ai161 (TIT2L-GFP-ICR-tTA2) targeting vector
Plasmid#114429PurposeTarget a Cre-dependent GFP cassette and Dre-dependent tTA2 cassette to the mouse TIGRE locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGFP
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
CSII-IDR2-owlTRIMCyp-FOS
Plasmid#79067PurposeExpress owl monkey TRIMCyp in mammalan cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTRIM5Cyp (owl monkey)-FOS
TagsOneSTrEP-FLAGExpressionMammalianPromoterCMVAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pT2-7xTcf-NLS-ONL-CP
Plasmid#65716PurposeTol2-based Wnt signal reporter plasmid (expresses NLS-ONL-CP)DepositorInsert7xTcf, minCMV, 3xNLS, ONL, hCL1-PEST
UseLuciferaseAvailable sinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-Alpha-5-Integrin-12
Plasmid#55401PurposeLocalization: Focal Adhesions, Excitation: 433, Emission: 475DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAlpha-5 Integrin (ITGA5 Human)
TagsmCerulean3ExpressionMammalianPromoterCMVAvailable sinceOct. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
MSCV N-term HA-FLAG puro BRD7 shRescue
Plasmid#41936DepositorAvailable sinceApril 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pIS1 IMP-1 short UTR
Plasmid#21639DepositorPublicationInsertIGF-II mRNA-binding protein 1 (IGF2BP1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable sinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pB-3xFlag-dCas13-mTET2CD
Plasmid#228234PurposeFor targeted tethering of the catalytic domain of mouse TET2 using dCas13DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsUseCRISPRExpressionMammalianMutationCD (cysteine-rich, dioxygenase domain) truncation…PromoterCAGAvailable sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-DAG1
Plasmid#205149PurposeOverexpress DAG1DepositorInsertDystroglycan 1 (DAG1 Human)
UseLentiviralExpressionMammalianMutationCarries common missense variant c.41C>G (p.Ser…PromoterEF-1aAvailable sinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
GLI1_pLENTI-CAG-IRES-GFP
Plasmid#176992PurposeMammalian lentiviral expression vector encoding GLI1DepositorAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOmnibac_ZZ_linker_ybbR_Tau
Plasmid#159717PurposeExpresses tau in Sf9 cells with a ZZ affinity tag and a ybbR tagDepositorInsertMicrotubule-associated protein tau (MAPT Human)
TagsZZ affinity tag, ybbR tagExpressionInsectAvailable sinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
BE3-hA3A-R128A
Plasmid#132944PurposeGene editing. See Gene/Insert section of the plasmid page for targeting sequence cloned into this plasmid.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBE3-hA3A(R128A)
UseCRISPR; Base editorExpressionMammalianMutationBE3-hA3A(R128A)Available sinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUB6-CDC34-HA (pRKB261)
Plasmid#99145PurposeMammalian expression construct to express HA-tagged CDC34DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCDC34 (CDC34 Human)
TagsHAExpressionMammalianPromoterpTightAvailable sinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMyc-C1-Cep123 (CCDC123/Cep89)
Plasmid#69836PurposeThis plasmid encodes Cep123 (CCDC123/Cep89) isoform 1 with an N-ter Myc-tagDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCep123 (CEP89 Human)
TagsMyc tagExpressionMammalianPromoterCMVAvailable sinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
TagBFP2-FKBP-PIP5K1C_Kina-HDD316K
Plasmid#202742Purposeexpresses recruitable fluorescent protein-tagged enzymeDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmTagBFP2:FKBP1A (3-108) : [GGSA]4GG : PIP5K1C(79-366) (D101R / R304D / D316K) (PIP5K1C Human)
ExpressionMammalianAvailable sinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
BC1441-mouse U6-3xsgRNAs (TS5, TS6, TS7)
Plasmid#164040PurposeExpression of three sgRNAs (sgTS5, sgTS6, sgTS7) for targeting to CRISPR-Tag_V2DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgTS5-sgTS6-sgTS7
UseCRISPRPromotermouse U6Available sinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only