We narrowed to 11,160 results for: cat.1
-
Plasmid#136043PurposeUPF3A shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCAGAAACCATTCTAAAGAAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only
-
Clover-Geminin(1-110)
Plasmid#83915PurposeFluorescent probe for M/G1 transitionDepositorInsertClover-Geminin(1-110)
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCdh2.1 GFP
Plasmid#209099PurposeGFP expressing shRNA targeting Cdh2DepositorInsertshCdh2.1
Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCtnnd2.1-GFP
Plasmid#209095PurposeGFP expressing shRNA targeting Ctnnd2 N-terminusDepositorInsertshCtnnd2.1
Available SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCdh20.1 GFP
Plasmid#209106PurposeGFP expressing scramble of shRNA targeting Cdh20DepositorInsertscrCdh20.1
Available SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPROEX Hsp104 (1-575)
Plasmid#1318DepositorInsertHsp104 (1-575) (HSP104 Budding Yeast)
Tags6X His + TEV cleavageExpressionBacterialMutationaa1-575 of Hsp104Available SinceJan. 21, 2005AvailabilityAcademic Institutions and Nonprofits only -
EGFP-1-SAC1deltaTMD-Fis1tail
Plasmid#220077PurposeSAC1 with the TMD deleted and replaced with the Fis1tail to replace the TMD and target the mitochondria instead of the ER with a Green FluorophoreDepositorAvailable SinceMay 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBS-beta1,4 GT-1
Plasmid#11872DepositorInsertbeta 1,4 galactosyltransferase (B4GALT1 Human)
ExpressionBacterialAvailable SinceMay 12, 2006AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - DDX3Y sgRNA 1
Plasmid#70656PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a DDX3Y targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against DDX3Y
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCdh2.1 GFP
Plasmid#209100PurposeGFP expressing scramble of shRNA targeting Cdh2DepositorInsertscrCdh2.1
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-HHARI(1-185)
Plasmid#17341DepositorAvailable SinceFeb. 19, 2008AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C3orf17 sgRNA 1
Plasmid#70652PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C3orf17 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C3orf17
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
SRF 1-133 pGEX4T1
Plasmid#121101PurposeExpression of SRF fragment as a GST fusion proteinDepositorAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 1
Plasmid#70655PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCdh11.1 GFP
Plasmid#209103PurposeGFP expressing shRNA targeting Cdh11DepositorInsertshCdh11.1
Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCdh11.1 GFP
Plasmid#209104PurposeGFP expressing scramble of shRNA targeting Cdh11DepositorInsertscrCdh11.1
Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCtnnd2.2-GFP
Plasmid#209098PurposeGFP expressing scramble of shRNA targeting Ctnnd2 3' UTRDepositorInsertscrCtnnd2.2
Available SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCdh10.1 GFP
Plasmid#209101PurposeGFP expressing shRNA targeting Cdh10DepositorInsertshCdh10.1
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCtnnd2.2-GFP
Plasmid#209097PurposeGFP expressing shRNA targeting Ctnnd2 3' UTRDepositorInsertshCtnnd2.2
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCtnnd2.1-GFP
Plasmid#209096PurposeGFP expressing scramble of shRNA targeting Ctnnd2 N terminusDepositorInsertscrCtnnd2.1
Available SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only