We narrowed to 11,495 results for: ANG
-
Plasmid#52009PurposeExpresses the human MAVS CDS containing the point mutation M1ADepositorInsertMAVS-M1A
UseRetroviralExpressionMammalianMutationchanged Met 1 to AlaAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRH8
Plasmid#101014Purposedominant negative glutamate receptor subunitDepositorInsertglutamate
ExpressionMammalianMutationCHANGED THE GLUR USING PRIMERS FOUND IN ROBERT ET…PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pMTL-YN1C Pcwp2::LP-mScI3 (G228R)
Plasmid#251226PurposepMTL-YN1C encoding mScarletI3 with a G228R mutation under the promoter for cwp2. This functions as a constitutive transcriptional reporter for visualizing C. difficile.DepositorInsertPcwp2::LP-mScI3 (G228R)
ExpressionBacterialMutationGlycine 228 changed to arginine.Promotercwp2Available SinceApril 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
AcrVA1_AsLOV2-S103ΔELS
Plasmid#246049PurposeExpression of AcrVA1-AsLOV2 hybrid in mammalian cells; insertion before S103 with deletion of surrounding amino acids ELS; enables optogenetic control of MbCas12aDepositorInsertAcrVA1_AsLOV2-S103ΔELS
UseCRISPR and Synthetic BiologyExpressionMammalianMutationΔELSAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_S273C
Plasmid#248864PurposeExpresses MBP-tagged C-terminal domain of TDP-43 with S273C.DepositorInsertTDP-43_CTD_S273C (TARDBP Human)
Tags6xHis tags-MBPExpressionBacterialMutationchanged S273CAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
VAMP3(S48E)-mCherry
Plasmid#193637PurposeExpresses S48E phosphomimetic VAMP3 fused to mCherryDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT/TO_Vimentin-HaloTag7_T2A_mEGFP
Plasmid#187074PurposeExpression of HaloTag7 located at the intermediate filaments of mammalian cellsDepositorInsertVimentin-HaloTag7
ExpressionMammalianAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSF_his6_sumo_SARS_CoV2_NSP14_V290A
Plasmid#213522PurposeExpresses NSP14 of SARS-CoV-2 with a single point mutation V290ADepositorInsertSARS-CoV-2 NSP14 (ORF1ab SARS-CoV-2)
TagsHis6-sumoExpressionBacterialMutationchanged V290 to AAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSF_his6_sumo_SARS_CoV2_NSP14_N306K
Plasmid#213523PurposeExpresses NSP14 of SARS-CoV-2 with a single point mutation N306KDepositorInsertSARS-CoV2-NSP14 (ORF1ab SARS-CoV-2)
TagsHis6-sumoExpressionBacterialMutationchanged N306 to KAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSF_his6_sumo_SARS_CoV2_NSP14_P335S
Plasmid#213524PurposeExpresses NSP14 of SARS-CoV-2 with a single point mutation P335SDepositorInsertSARS-CoV-2 NSP14 (ORF1ab SARS-CoV-2)
TagsHis6-sumoExpressionBacterialMutationchanged P335 to SAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSF_his6_sumo_SARS_CoV2_NSP14_P335H
Plasmid#213525PurposeExpresses NSP14 of SARS-CoV-2 with a single point mutation P335HDepositorInsertSARS-CoV-2 NSP14 (ORF1ab SARS-CoV-2)
TagsHis6-sumoExpressionBacterialMutationchanged P335 to HAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only