We narrowed to 2,516 results for: BFP
-
Plasmid#199363PurposeLentiviral transfer plasmid for doxycycline inducible expression of a C-terminally ALFA-P2A-BFP-tagged protein in mammalian cells.DepositorTypeEmpty backboneUseLentiviralTagsALFA-P2A-TagBFPExpressionMammalianMutationWTAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pSA091 PSMD14_IVS2-Cas9-BFP
Plasmid#249141PurposeOverexpression of SpCas9-BFP with PSMD14 IVS2 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertPSMD14_IVS2-Cas9-TagBFP (PSMD14 S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationPSMD14 IVS2 intronPromoterEF1aAvailable SinceJan. 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SOX2_v32_7-4)-PGKpuroBFP-W
Plasmid#211986PurposeExpress gRNA against SOX2 with puro and BFPDepositorInsertsgRNA targeting SOX2 (SOX2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SOX2_v32_7-5)-PGKpuroBFP-W
Plasmid#211987PurposeExpress gRNA against SOX2 with puro and BFPDepositorInsertsgRNA targeting SOX2 (SOX2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-h-mmPtch1-B-V111FL114FI766F-HA-TagBFP
Plasmid#120911PurposeExpresses BFP tagged Ptch1-B (V111FL114FI766F)DepositorInsertPtch1 (Ptch1 Mouse)
TagsHA and TagBFPExpressionMammalianMutationdeleted amino acids 620-643, truncated at 1291, Y…PromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTubulin-Electra2
Plasmid#184930PurposeTubulin labeling with blue fluorescent protein Electra2DepositorInsertTUBA1B-Electra2
TagsElectra2ExpressionMammalianPromoterCMVAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-BFP
Plasmid#202823PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete exon 1 within ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC_hU6-shRKIP_BFP
Plasmid#199216PurposeExpression plasmid with shRNAmiR targeting RKIP (PEBP1), with a BFP reporter on the backbone.DepositorAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcg 2.0-BFP-circ-arRNA backbone
Plasmid#213965Purposepcg 2.0-BFP-circ-arRNA backbone included a Twister P3 U2A, 5’ ligation sequence, a 3’ ligation sequence and Twister P1 based on pLenti-sgRNA-lib 2.0 backbone (Addgene no. 89638). Then, the sequences oDepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSA127 A2UCOE-Cas9-BFP
Plasmid#249151PurposeOverexpression of SpCas9-BFP and blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-Cas9-TagBFP
UseCRISPR; Cp36 donor dnaExpressionMammalianPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hEGFR_2b)-PGKpuro2ABFP-W
Plasmid#208432PurposeLentiviral gRNA plasmid targeting human EGFR gene, co-expression of BFP tagDepositorInsertEGFR (EGFR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPTPN11_1k)-PGKpuro2ABFP-W
Plasmid#208427PurposeLentiviral gRNA plasmid targeting human PTPN11 gene, co-expression of BFP tagDepositorInsertPTPN11 (PTPN11 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPTPN11_2b)-PGKpuro2ABFP-W
Plasmid#208428PurposeLentiviral gRNA plasmid targeting human PTPN11 gene, co-expression of BFP tagDepositorInsertPTPN11 (PTPN11 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMTOR_1k)-PGKpuro2ABFP-W
Plasmid#208429PurposeLentiviral gRNA plasmid targeting human MTOR gene, co-expression of BFP tagDepositorInsertMTOR (MTOR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMTOR_2b)-PGKpuro2ABFP-W
Plasmid#208430PurposeLentiviral gRNA plasmid targeting human MTOR gene, co-expression of BFP tagDepositorInsertMTOR (MTOR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hEGFR_1k)-PGKpuro2ABFP-W
Plasmid#208431PurposeLentiviral gRNA plasmid targeting human EGFR gene, co-expression of BFP tagDepositorInsertEGFR (EGFR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
Ef1a-pspCas13b-NES-3xFLAG-T2A-BFP
Plasmid#173029PurposeFor expression of cytoplasmic pspCas13b protein tagged with 3xHA-T2A-BFP for gene silencing in mamallian cells.DepositorInsertpspCas13b
UseCRISPR and LentiviralTags3xFLAG, BFP, HIV NES, and T2AExpressionMammalianPromoterEf1aAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTMN140 - UCOE-SFFV-VPH-XTEN-dCas9-IRES2-BFP-T2A-Blast
Plasmid#238166PurposeExpress VPH-dCas9 and BFP-T2A-BlasticidinR in mammalian cells. LentiviralDepositorInsertVPH-dCas9
UseCRISPR and LentiviralTagsmTagBFP2Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only