We narrowed to 23,940 results for: promoter
-
Plasmid#196537PurposeExpression of GST-Eps8L2_297-370DepositorInsertEps8L2_297-370 (EPS8L2 Human)
TagsGSTExpressionBacterialPromoterT7 promoter; lac UV5 promoterAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST15-Eps8L2_367-496
Plasmid#196538PurposeExpression of GST-Eps8L2_367-496DepositorInsertEps8L2_367-496 (EPS8L2 Human)
TagsGSTExpressionBacterialPromoterT7 promoter; lac UV5 promoterAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST15-Eps8L2_494-546
Plasmid#196539PurposeExpression of GST-Eps8L2_494-546DepositorInsertEps8L2_494-546 (EPS8L2 Human)
TagsGSTExpressionBacterialPromoterT7 promoter; lac UV5 promoterAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGS_591
Plasmid#160653PurposeExpresses OLE1 under the control of the yeast Sup35 promoterDepositorAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV puro PRDM14 ΔSET domain
Plasmid#193680PurposeConstitutive retroviral expression of PRDM14DepositorAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV puro PRDM14 ΔZinc finger domain
Plasmid#193679PurposeConstitutive retroviral expression of PRDM14DepositorAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV puro PRDM14
Plasmid#193677PurposeConstitutive retroviral expression of PRDM14DepositorInsertPRDM14 (PRDM14 Human)
UseRetroviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV puro PRDM14 ΔSET+ΔZinc finger domains
Plasmid#193678PurposeConstitutive retroviral expression of PRDM14DepositorAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free NES
Plasmid#182482PurposeYeast integrative plasmid for expressing ERG20 (GAL10 promoter) and nerolidol synthase from Actinidia chinensis (AcNES1; GAL7 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsFPPS
NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free PcPTS
Plasmid#182483PurposeYeast integrative plasmid for expressing ERG20 (GAL10 promoter) and patchoulol synthase from Pogostemon cablin (PcPTS; GAL7 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsFPPS
PTS
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pM-mRuby2
Plasmid#176550PurposeExpression of mRuby2 for auxotrophic selection in the absence of methionineDepositorInsertyomRuby2
ExpressionYeastPromoterTDH1(GAP)Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-GFP-AnillinA740D, E758K
Plasmid#187274PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin A740D,E758KDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsEGFPMutationAnillin A740D, E758KPromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-mDia1-GBD (1-305 aa) in pEGFPN1
Plasmid#187280PurposeExpress EGFP-mDia1 GTPase-binding domainDepositorAvailable SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
IL2-mCherry-rGBD in pmCherryN1
Plasmid#187286PurposeExpress IL2-Rhotekin GTPase-binding domain-mCherryDepositorTagsmCherryExpressionMammalianPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_219
Plasmid#180534PurposeEntry vector containing K.rhaeticus native promoter pCmcAX (bcs1) (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pCmcAX (bcs1) (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_223
Plasmid#180538PurposeEntry vector containing K.rhaeticus native promoter pHxu (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pHxu (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET-osr1-KI-donor
Plasmid#184875PurposeDonor template for knock-in of p2a-CreERT2 into the medaka osr1 locus via CRISPR/Cas9-mediated homology directed repairDepositorInsertsOdd-Skipped Related Transcription Factor 1 5' homology arm
Odd-Skipped Related Transcription Factor 1 3' homology arm
p2a-CreERT2
Myosin light chain 2 promoter
EGFP
UseCRISPR and Cre/LoxAvailable SinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_226
Plasmid#180552PurposeEntry vector containing K.rhaeticus native promoter pRutB (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pRutB (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRR-C421-G2304D
Plasmid#182845Purposemutation G2304D (GGC/GAC), PCR product coding C-terminal residues 2011-2431 of TRR was inserted into modified pGEX-2T by Nde I-Nsi I sitesDepositorAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only