We narrowed to 1,318 results for: V2
-
Plasmid#211521PurposeDeletes UGP2DepositorInsertsgUGP2
UseCRISPR and LentiviralExpressionMammalianAvailable sinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CHyMErA.v2_U6(SpCas9_I-SceI)-(AsCas12a(dual-gRNA)_PacI-PacI)_PGK-puro
Plasmid#189636PurposeLentiviral expression of single SpCas9 and dual AsCas12a gRNAs for generating combinatorial CHyMErA.v2 3Cs librariesDepositorInserthU6 Cas9-Cas12a-Cas12a gRNA cassette, PGK puro cassette
UseCRISPR and LentiviralExpressionMammalianAvailable sinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti_mpx_SpCas9_h7SK(PacI)_U6(I-SceI)_PGK-puro_v2
Plasmid#189632PurposeLentiviral expression of dual SpCas9 gRNAs for generating combinatorial SpCas9 3Cs librariesDepositorInserth7SK Cas9 gRNA cassette, hU6 Cas9 gRNA cassette, PGK puro cassette
UseCRISPR and LentiviralExpressionMammalianAvailable sinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lentiCRISPR v2-sgABI2-1
Plasmid#210139Purposeknock out ABI2 in mammalian cellsDepositorInsertAbl interactor 2 (ABI2 Human)
UseCRISPRAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgCYFIP1-1
Plasmid#210137Purposeknock out CYFIP1 in mammalian cellsDepositorInsertCytoplasmic FMR1-interacting protein 1 (CYFIP1 Human)
UseCRISPRAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgABI2-2
Plasmid#210140Purposeknock out ABI2 in mammalian cellsDepositorInsertAbl interactor 2 (ABI2 Human)
UseCRISPRAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgWAVE2-2
Plasmid#210136Purposeknock out WAVE2 in mammalian cellsDepositorInsertActin-binding protein WASF2 (WASF2 Human)
UseCRISPRAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgWAVE2-1
Plasmid#210135Purposeknock out WAVE2 in mammalian cellsDepositorInsertActin-binding protein WASF2 (WASF2 Human)
UseCRISPRAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgHSPC300-1
Plasmid#210141Purposeknock out HSPC300 in mammalian cellsDepositorInsertProtein BRICK1 (BRK1 Human)
UseCRISPRAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgHSPC300-2
Plasmid#210142Purposeknock out HSPC300 in mammalian cellsDepositorInsertProtein BRICK1 (BRK1 Human)
UseCRISPRAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCI_E01_mini-mAgrin-Myc-His-WPRE_v2
Plasmid#198128PurposeExpress mini-Agrin in mammalian cellsDepositorInsertmini-Agrin (Agrn Mouse)
TagsTEV-Myc-HisExpressionMammalianPromoterCMV, beta-globin/IgG chimeric intronAvailable sinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_CmYLCVp_35sT_ribozyme_AtPDS3_gRNA10
Plasmid#197958PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by CmYLCVp and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterCmYLCVp and pUBQ10Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_2x35Sp_HSP18t_ribozyme_AtPDS3_gRNA10
Plasmid#197959PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by 2x35Sp and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoter2x35S promoter and pUBQ10Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_pUB10_E9t_ribozyme_AtPDS3_gRNA10
Plasmid#197960PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by UBQ10 gene promoter and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterpUBQ10Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-vCASphi_E9t_V2_U6_AtPDS3_gRNA10
Plasmid#197963PurposeT-DNA binary vector to express pco-vCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by U6 promoter.DepositorInsertspco-vCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterAtU6-26 and pUBQ10Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-nCASphi_E9t_V2_CmYLCVp_35sT_ribozyme_AtPDS3_gRNA10
Plasmid#197980PurposeT-DNA binary vector to express pco-nCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by CmYLCVp, flanked by ribozymes.DepositorInsertspco-nCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterCmYLCVp and pUBQ10Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC57-mini v2-HF24_F4
Plasmid#195718PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#4 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable sinceMarch 20, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F20
Plasmid#195734PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#20 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable sinceMarch 16, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F5
Plasmid#195719PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#5 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable sinceMarch 16, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits