We narrowed to 19,497 results for: INO
-
Plasmid#190223PurposeFluorescent cell cycle reporterDepositorInsertsUseTransposonTagsClover fluorescent proteinExpressionMammalianMutationAmino Acids 994-1087PromoterEF1a and RPBSAAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only
-
Ef1a-pspCas13b-NES-3xFLAG-T2A-BFP
Plasmid#173029PurposeFor expression of cytoplasmic pspCas13b protein tagged with 3xHA-T2A-BFP for gene silencing in mamallian cells.DepositorInsertpspCas13b
UseCRISPR and LentiviralTags3xFLAG, BFP, HIV NES, and T2AExpressionMammalianPromoterEf1aAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pvalb-2A-Cre targeting vector
Plasmid#61570PurposeTarget the Cre recombinase gene to the stop codon of the mouse Pvalb geneDepositorInsertPvalb exon 4 - 2A - Cre
UseCre/Lox and Mouse TargetingAvailable SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
Flag_HsIRE1a_deltaP29_D408_pBabePuro
Plasmid#58422Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant human IRE1a deleted from amino acids P28 to D408DepositorInsertIRE1a (ERN1 Human)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationDeleted amino acids P29 to D408Available SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV1A
Plasmid#224437PurposeRep/Cap plasmid for the production of MyoAAV 1A, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDLTTP insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT/DEST-3xHA/mGli3/Flag P1-6A
Plasmid#51248PurposeEncodes N-3xHA-TEV-mouseGli3-Flag-C; amino acids 849,865,877,907,980,1006 mutated to AlaDepositorInsertGli3 (Gli3 Mouse)
UseFlpin systemTags3xHA-TEV and FlagExpressionMammalianMutationamino acids 849,865,877,907,980,1006 mutated to A…PromoterEF1aAvailable SinceMarch 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-MmACE2 (Mouse)
Plasmid#158087PurposeExpresses mouse ACE2 in mammalian cellsDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4E
Plasmid#224452PurposeRep/Cap plasmid for the production of MyoAAV 4E, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDFNNT insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBFC0993
Plasmid#231993PurposeCRISPRi-ART plasmid encoding aTc-inducible dRfxCas13d and constitutive crRNA with negative control (RFP-targeting) spacerDepositorInsertsdRfxCas13d
crRNA with negative control (RFP-targeting) spacer
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and pTetAvailable SinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDNA2.0 6H-TEV-KRAS
Plasmid#111849PurposeExpresses wild type human KRAS (amino acids 1 - 169) in E. coli with amino terminal 6xHIS tag that can be removed with TEV protease.DepositorInsertKRAS (KRAS Human)
Tags6xHis-tag and TEV protease cleavage sequenceExpressionBacterialPromoterT5Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs T3950D
Plasmid#83320PurposeDNA-PKcs T3950ADepositorInserthuman DNA-PKcs (PRKDC Human)
ExpressionMammalianMutationActivation loop phosphorylation site 3950 substit…Available SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-GCaMP6F
Plasmid#137123PurposeIntersectional viral expression of GCaMP6F in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-GCaMP6F
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationRemoved RSET tagPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX_314-HRI-V5
Plasmid#202434PurposeExpression of HRIDepositorAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-kz-CD20-Puro
Plasmid#209759PurposeLentiviral transfer plasmid to express the CDS of the human CD20 gene, MS4A1.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB53x EF1-Dendra2-RPB1Amr
Plasmid#81228Purposeexpresses Dendra2-Rpb1 fusion in mammalian cells. Possible to insert into the genome using the Piggibac systemDepositorInsertDendra2 - Rpb1 (alpha amanitin resistant) (POLR2A Human)
TagsDendra2ExpressionMammalianMutationN792D alpha amanitin resistance mutation (Bartolo…PromoterEF1aAvailable SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AMBRA1-3xFLAG
Plasmid#172605PurposeExpresses 3xFLAG-tagged AMBRA1 in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
mGFP-hNET
Plasmid#193364Purposeexpression of human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cellsDepositorInserthuman Norepinephrine Transporter (SLC6A2 Human)
Tagsmonomeric GFP (mGFP)ExpressionMammalianPromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX2-tTA2-WPRE-bGHpA
Plasmid#65458PurposeCan be used to generate AAV virus that will express the tetracycline transactivator tTA2 from the CAG promoter in a Cre-dependent mannerDepositorInserttTA2
UseAAVPromoterCAGAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only