We narrowed to 9,891 results for: tre promoter
-
-
-
-
-
-
-
-
pSG059
Plasmid#214262PurposePaFtsH2-6xHis cloned in XbaI/NheI site in pET-28a(+)DepositorInserttLST accessory element PaFtsH2 protease of Pseudomonas aeruginosa SG17M
Tags6x His-tag and 6xHis-tagExpressionBacterialPromoterT7 promoterAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
10X PRE TK luc
Plasmid#206162PurposeLuciferase reporter construct containing 10 consensus PGR binding sites upstream of a minimal TK promoter, derived from Addgene #11350DepositorInsert10X PRE TK luciferase
UseLuciferaseExpressionMammalianPromotermin TKAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
8X PRE TK luc
Plasmid#206161PurposeLuciferase reporter construct containing 8 consensus PGR binding sites upstream of a minimal TK promoter, derived from Addgene #11350DepositorInsert8X PRE TK luciferase
UseLuciferaseExpressionMammalianPromotermin TKAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
6X PRE TK luc
Plasmid#206160PurposeLuciferase reporter construct containing 6 consensus PGR binding sites upstream of a minimal TK promoter, derived from Addgene #11350DepositorInsert6X PRE TK luciferase
UseLuciferaseExpressionMammalianPromotermin TKAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFSynW pHluorin-SYT9 IRES mRuby3
Plasmid#195698PurposeLentiviral plasmid encoding SYT9 with an N-terminal pHluorin tag followed by an internal ribosomal entry site followed by mRuby3 under the human synapsin promoterDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFSynW Syt9 IRES mRuby3
Plasmid#195700PurposeLentiviral plasmid encoding full-length mouse SYT9 followed by an internal ribosomal entry site followed by mRuby under the human synapsin promoterDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
1BR9-AtWUSSTOP
Plasmid#202053PurposeE. coli expression vector for N-ter GFP11 tagged Arabidopsis thaliana WUSCHELDepositorInsertAtWUS E. Coli Codon Optimized (WUS Mustard Weed)
Tags6xHis and GFP11ExpressionBacterialPromoterT7 PromoterAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-nsp7
Plasmid#201025PurposeExpresses SARS-CoV-2 nsp7 under control of a tetracycline-inducible promoter in mammalian.DepositorInsertnon-structural protein 7 (ORF1ab Synthetic, Severe acute respiratory syndrome coronavirus 2)
ExpressionMammalianPromoterCMV-tet-ONAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBABR mCherry-Bcd-LEXY
Plasmid#182596PurposeDrosophila integration plasmid expressing mCherry-Bcd-LEXY fusion protein under the maternal tubulin promoter.DepositorAvailable SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hPPP3R2
Plasmid#179163PurposeExpression vector of human protein phosphatase 3, regulatory subunit B, beta isoform (PPP3R2), CAG promoter, rabbit globin poly(A) signal.DepositorInsertprotein phosphatase 3, regulatory subunit B, beta isoform (PPP3R2 Human)
ExpressionMammalianAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mPpp3r2
Plasmid#179161PurposeExpression vector of mouse protein phosphatase 3, regulatory subunit B, beta isoform (Ppp3r2), CAG promoter, rabbit globin poly(A) signal.DepositorInsertprotein phosphatase 3, regulatory subunit B, beta isoform (Ppp3r2 Mouse)
ExpressionMammalianAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hSPATA33-8xHIS-1D4
Plasmid#179133PurposeExpression vector of human spermatogenesis associated 33 (SPATA33) tagged with 8XHIS and 1D4 at C-terminus, CAG promoter, rabbit globin poly(A) signal.DepositorAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only
