We narrowed to 4,229 results for: PRS
-
Plasmid#185086PurposeNMA111 with both nuclear localization signals mutated to alanines fused to GFP (mutagenesis of KBB280)DepositorInsertNMA111
TagsGFPExpressionYeastMutationNma111 KKR 9-11 AAA; KRK 28-30 AAAAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB349
Plasmid#185080Purposerfa2D248 truncation fused to GFPDepositorInsertRFA2
TagsGFPExpressionYeastMutationRfa2 truncation aa 1-247Available SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB353
Plasmid#185081PurposeSwi6M-GFP expressing N-term 181 amino acids of Swi6DepositorInsertSWI6
TagsGFPExpressionYeastMutationSwi6 truncation aa 1-181Available SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB484
Plasmid#185132PurposeSWI6-GFP full length under control of GAL1 promotionDepositorInsertSWI6
TagsGFPExpressionYeastAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ecm2 1-197
Plasmid#169924PurposeWT Ecm2 mutated to introduce stop codon after AA 197 of Ecm2DepositorInsertEcm2 1-197
ExpressionBacterial and YeastAvailable SinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBHRSF228
Plasmid#135007PurposeMusF2 prenyltransferases from Nostoc sp. UHCC 0398DepositorInsertMusF2 prenyltransferase
ExpressionBacterialAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
VanR - F165V
Plasmid#158965PurposeWild type VanR where the residue in position 165 was mutated from Phenylalanine to Valine. This mutation abolished the response to vanillic acid. The gene is under the control of the TEF1 promoter.DepositorInsertVanR - F165V
ExpressionYeastMutationWild type VanR from Caulobacter crescentus with m…PromoterTEF1Available SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
VanR - F165R
Plasmid#158966PurposeWild type VanR where the residue in position 165 was mutated from Phenylalanine to Arginine. This mutation abolished the response to vanillic acid. The gene is under the control of the TEF1 promoter.DepositorInsertVanR - F165R
ExpressionYeastMutationWild type VanR from Caulobacter crescentus with m…PromoterTEF1Available SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMP89b CvTA V124N
Plasmid#141207PurposeChromobacterium violaceum transaminase with enhances affinity for PLP. TEV cleaving site after the N-terminal Histag.DepositorInsertCvTA
ExpressionBacterialMutationV124NAvailable SinceJune 15, 2020AvailabilityAcademic Institutions and Nonprofits only