Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 50 results for: PRS

Showing: 1 - 20 of 50 results

  1. Educational Planarian Tools for Teaching Developmental Biology Techniques

    Type
    Blog Post
    ... into the empty PR-T4P vector backbone. The empty vector PLL4, which is similar to PR-T4P, is available...these planarian species. These plasmids all have a PR-T4 vector backbone, which is a modified version of...sequences for creating riboprobes and dsRNAs into PR-T4P. The Sánchez lab protocol also provides step-...

  4. Plasmids 101: Inducible Promoters

    Type
    Blog Post
    ...Repressor cI inhibits transcription from phage promoter pR, preventing expression of a reporter gene. When light...

  7. Sequencing Primers

    Type
    Guide
    ...forward primer pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Pry1 ...

  12. Bacterial Expression Systems

    Type
    Collection
    ...Lab pBEST plasmids Various Plasmids pBAD, OR2-OR1-PR, pLtetO, pLlacO Arabinose, Anhydrotetracycline, lactose...fluorescent protein variant (CyPet) found in pCyPet-His . pRSETa mEos2 20341 mEos2 (fluorescent protein) Loren Looger...

  13. 15 Years of Addgene: The Top 15 Plasmids

    Type
    Blog Post
    ...plasmid predates Addgene’s founding. Find pCMV-VSV-G. pRSV-Rev - This 3rd generation lentiviral packaging plasmid...plasmid pMD2.G, both deposited from the same lab. Find pRSV-Rev. pMDLg/pRRE - This is a 3rd generation lentiviral...contains the gag and pol genes. It also requires pRSV-Rev and the envelope expressing plasmid pMD2.G. ...

  14. Optogenetics + CRISPR, Using Light to Control Genome Editing

    Type
    Blog Post
    ...CRISPR-based systems in animal models. Use Anti-CRISPRs to Turn Off Genome Editing Single-chain Cas9 photoswitches... saCas9 protein. Stop light! Photoactive anti-CRISPRs halt Cas9 activity Anti-CRISPR proteins are a highly... study kinetics. Using chemistry to photocage CRISPRs The aforementioned techniques each employed a photoactive...

  15. Keeping Up With CRISPR/Cas9

    Type
    Blog Post
    ...already. I know we've discussed it before, but CRISPRs allow research to move so fast." On the very same...microbiome alone. (Seriously, is there anything CRISPRs can't do?) Structural details All this, and scientists...

  20. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...plasmids. (Kearns et al., Development. 2014..) CRISPRs for Xenopus! From the lab of Yonglong Chen, pCS2...genome editing system that combines TALENs and CRISPRS. Developed by David Liu and colleagues, FokI-dCas9...
Showing: 1 - 20 of 50 results