We narrowed to 82,587 results for: myc
-
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPD1178-LPDV promoterless PuroR-P2A-miRFP720
Plasmid#201537PurposeLanding pad destination vector for mMoClo golden gate-based assembly of landing pad integration vectors; contains BxB1 attB site, promoterless puromycin resistance gene and miRFP720 geneDepositorInsertPromoterless PuroR-P2A-miRFP720
ExpressionMammalianPromoterNoneAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-SF14P
Plasmid#209448Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the SF14P promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from SF14P promoterAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-kasOP*
Plasmid#209447Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the kasOP* promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from kasOP* promoterAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
ClhN-P1K-3VSV-Atg8(L55W T56A V61W R65A)-MET15
Plasmid#207054PurposeExpression of 3VSV-Atg8 point mutant. Uses auxotrophic marker MET15(Saccharomyces cerevisiae).DepositorInsertATG8
Tags3xVSVExpressionYeastMutationL55W T56A V61W R65AAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-NUbo-E3(48)-mCherry-P2A-3xFLAG-Ubc7
Plasmid#212805PurposeConstitutive or doxycycline-inducible expression of NUbo-E3(48)-mCherry-P2A-3xFLAG-Ubc7 in mammalian cellsDepositorInsertNUbo-E3(48)-mCherry-P2A-3xFLAG-Ubc7
ExpressionMammalianAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF3447
Plasmid#144923PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEE054
Plasmid#176811PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert605
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-mCherry-FLARE-CKAR
Plasmid#123345PurposeRed-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase C activity.DepositorInsertmCherry-mCherry-FLARE-CKAR
Tags6xHIS, T7 tag (gene 10 leader), Xpress (TM) tag, …ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-Cerulean3-FLARE-AKAR
Plasmid#123335PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertCerulean3-Cerulean3-FLARE-AKAR
Tags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyso-AktAR2
Plasmid#64933PurposeLysosome-targeted FRET biosensor for monitoring Akt activity; targeted to cytosolic face of lysosomal membrane.DepositorInsertLAMP1-AktAR2 (LAMP1 Human, Synthetic, Budding Yeast)
TagsCerulean3, Full-length LAMP1, and cpVenus[E172]ExpressionMammalianPromoterCMVAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-dCas9-KRAB-PGK-HygR
Plasmid#83890PurposeLentiviral Sp dCas9-KRAB fusion with Hygromycin B resistance cassette.DepositorInsertshumanized dead Cas9 KRAB
aminoglycoside phosphotransferase from E. coli
UseCRISPR and LentiviralTagsFlagMutationD10A and H840APromoterHuman Ubiquitin C Promoter and mouse phosphoglyce…Available SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEX-PK-hLC3
Plasmid#61458PurposeExpress pHluorin-mKate2-hLC3 (PK-hLC3) in mammalian cells for monitoring autophagyDepositorAvailable SinceFeb. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-(inactive)CNOT6-V5H6.MCh.Puro
Plasmid#209943PurposeIn mammalian cells expresses TP fused to an inactive CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 6 (enzymatically inactive) (CNOT6 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-Ef1a-mCh-Puro
Plasmid#31845PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both mCherry and shRNA to be recombined out of the construct, turning OFF shRNA expression. Includes puromycin selection.DepositorTypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for shRNA; Ef1alpha for mCherry-puromycinAvailable SinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHSN6A01
Plasmid#50586PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHSN6I01
Plasmid#50587PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 that is defective in DNA cleavage; the maiz…Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-E1MLS-2xFLAG-LigD-IRES-tdTomato
Plasmid#234951PurposeHuman codon optimized LigD (Mycobacterium) with N-terminal E1 MLS expressing plasmidDepositorInsertHuman codon optimized LigD with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
UseLentiviralTagsFLAGExpressionMammalianPromoterEF1AAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
hZMPSTE24-3FLAG_pQCXIP
Plasmid#89759PurposeHuman ZMPSTE24 mammalian expression vector. Retroviral bicistronic puromycin vector.DepositorInsertHomo sapiens zinc metallopeptidase STE24 (ZMPSTE24) (ZMPSTE24 Human)
UseRetroviral; Bicistronic expression: puromycin re…Tags9bp spacer (NotI site) - 3xFLAG epitopes - Stop c…ExpressionMammalianMutationY253H in ZMPSTE24 (see depositor comments below)PromoterCMVAvailable SinceJune 8, 2017AvailabilityAcademic Institutions and Nonprofits only