We narrowed to 12,918 results for: HAL
-
Plasmid#221249PurposeExpression of TRIF truncation 3 (64-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pMSCV-FKBP-TRIF(trunc 1-83)
Plasmid#221250PurposeExpression of TRIF truncation 4 (84-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TRIF(trunc 1-103)
Plasmid#221251PurposeExpression of TRIF truncation 5 (104-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TRIF(trunc 1-23)
Plasmid#221247PurposeExpression of TRIF truncation 1 (24-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS3
Plasmid#184886PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS1
Plasmid#184884PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-K22R
Plasmid#220293Purposemammalian expression of Bcl-2-K22R tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-G101V
Plasmid#220295Purposemammalian expression of Bcl-2-G101V tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-K17R
Plasmid#220292Purposemammalian expression of Bcl-2-K17R tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-ΔBH1
Plasmid#220297Purposemammalian expression of Bcl-2-ΔBH1 tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-F104C
Plasmid#220296Purposemammalian expression of Bcl-2-F104C tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-ΔBH3
Plasmid#220299Purposemammalian expression of Bcl-2-ΔBH3 tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-ΔBH2
Plasmid#220298Purposemammalian expression of Bcl-2-ΔBH2 tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-T132L
Plasmid#220303Purposemammalian expression of Bcl-2-T132L tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-A131L
Plasmid#220302Purposemammalian expression of Bcl-2-A131L tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl-2-G128L
Plasmid#220301Purposemammalian expression of Bcl-2-G128L tagged with GFPDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKM 1996
Plasmid#217825PurposeExpresses putative photoreceptor SA-phr1 from S. alba. This gene shows high homology to the phr genes in prokaryotes.DepositorInsertSA-phr1
TagsMaltose-binding proteinExpressionBacterialAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtTAS1c-D2-NbSu-2-AtMIR173a
Plasmid#213401PurposePlant expression vector (2x35S) for expressing a syn-tasiRNA against Nicotiana benthamiana SULFUR gene from AtTAS1c precursorDepositorInsertArabidopsis TAS1c with a syn-tasiRNA sequence at D2 for silencing N. benthamiana SULFUR gene. MIR173 cassette.
ExpressionPlantPromoter2x35SAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only