We narrowed to 24,235 results for: c-MYC
-
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJT309 RapInducible1-ActivatorCloneSite-Citrine
Plasmid#187321PurposeRapamycin inducible genetic circuit with cloning site for activator domainsDepositorTypeEmpty backboneExpressionMammalianAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
pET28 His6-mEGFP-D4H
Plasmid#226373PurposeProduction of recombinant mEGFP-D4H, a fluorescent probe binding cholesterolDepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME GFP-PCNA
Plasmid#105977Purposeentry clone for gateway cloning, cell cycle marker proliferative cell nuclear antigen PCNADepositorAvailable SinceFeb. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
EC71171
Plasmid#154069PurposeLevel 0 Golden Gate vector, CRE with U5 intron at 254bp, in pICH41308 backboneDepositorInsertCRE_U5intron
UseSynthetic BiologyMutationAll BsaI, Esp3I and BPiI restriction sites were r…Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-AMPKsub-YPet-NES
Plasmid#84635PurposeEncodes C-terminal (substrate) fragment of bimolecular AMPK/BRSK activity reporter (bimABKAR); cytosol targeted; use in conjunction with pcDNA3-Cerulean-FHA1-NESDepositorInsertAMPKsub-YPet-NES
Tags6xHis, Nuclear export signal (NES), T7 tag (gene …ExpressionMammalianPromoterCMVAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only