We narrowed to 778 results for: 1182
-
Plasmid#1182DepositorAvailable SinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
pKLV2-U6gRNA5(CXCR4-E1(16))-PGKpuro2ABFP-W
Plasmid#200479PurposeLentiviral vector expressing gRNA targeting human CXCR4-E1DepositorInsertCXCR4-E1(16) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ARID1A(42))-PGKpuro2ABFP-W
Plasmid#200467PurposeLentiviral vector expressing gRNA targeting human ARID1ADepositorInsertARID1A(42) (ARID1A Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-E4(59))-PGKpuro2ABFP-W
Plasmid#200485PurposeLentiviral vector expressing gRNA targeting human CXCR4-E4DepositorInsertCXCR4-E4(59) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ARID1A(44))-PGKpuro2ABFP-W
Plasmid#200468PurposeLentiviral vector expressing gRNA targeting human ARID1ADepositorInsertARID1A(44) (ARID1A Human)
UseLentiviralAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-E2(37))-PGKpuro2ABFP-W
Plasmid#200480PurposeLentiviral vector expressing gRNA targeting human CXCR4-E2DepositorInsertCXCR4-E2(37) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-SE(96))-PGKpuro2ABFP-W
Plasmid#200477PurposeLentiviral vector expressing gRNA targeting human CXCR4-SEDepositorInsertCXCR4-SE(96) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.EFS.eGFP.mArid3a-3'UTR-Mut
Plasmid#169298PurposeConstitutive overexpression a mutated 3'UTR of the murine Arid3a gene after a GFP, to evaluate miRNA binding. Regions not containing miR-125b or let-7c binding regions not included.DepositorInsertArid3a-3'UTR-Mut (Arid3a Mouse)
UseLentiviralMutationMutations in miR-125b-2 and let-7c binding sitesPromoterEFSAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.EFS.eGFP.ARID3A-3'UTR-Mut
Plasmid#169296PurposeConstitutive overexpression a mutated 3'UTR of the human ARID3A gene after a GFP, to evaluate miRNA binding. Regions not containing miR-125b or let-7c binding regions not included.DepositorInsertARID3A-3'UTR-Mut (ARID3A Human)
UseLentiviralMutationMutations in miR-125b-2 and let-7c binding sitesPromoterEFSAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(SMARCA2(46))-PGKpuroBFP-W
Plasmid#200504PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and SMARCA2DepositorAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(AAVS1)-PGKpuroBFP-W
Plasmid#200503PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and AAVS1DepositorAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(SMARCA2(47))-PGKpuroBFP-W
Plasmid#200505PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and SMARCA2DepositorAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-HDRT-CD3z-truncCARgsg(anti-CD19)
Plasmid#215759PurposeHDR template to insert a truncated CD3-zeta-deficient CD19-CAR into CD247 exon 2 (enhanced expression by GSG-2A linker)DepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-HDRT-CD3z-truncCAR(anti-CD19)
Plasmid#215758PurposeHDR template to insert a truncated CD3-zeta-deficient CD19-CAR into CD247 exon 2DepositorAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(ARID1B(21))-PGKpuroBFP-W
Plasmid#200507PurposeLentiviral vector expressing gRNA targeting human ARID1A and ARID1BDepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(ARID1B(23))-PGKpuroBFP-W
Plasmid#200508PurposeLentiviral vector expressing gRNA targeting human ARID1A and ARID1BDepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only