We narrowed to 6,946 results for: crispr cas9 plasmids
-
Plasmid#232101PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only
-
eGFPbait-E2A-KalTA4-pA donor vector
Plasmid#61069Purposefor CRISPR/Cas9 mediated insertion of E2A-KalTA4; to be used in combination with a eGFP specific sgRNA (e.g. Plasmid 61051)DepositorInsertseGFPbait
KalTA4
UseZebrafish expressionTagsE2AAvailable SinceFeb. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRGEB33
Plasmid#158151PurposeConstruction of inPTG-Cas9 plasmids expressing gRNA within an engineered intron for binary vector plant genome editing.DepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRGEB34
Plasmid#158152PurposeConstruction of inPTG-Cas9 plasmids with a truncated 5'-UTR intron for plant genome editingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-TREX2-N
Plasmid#244022PurposeGateway entry plasmid (attL1& attR5) expressing TREX2 exonuclease fused to the N-terminus of zSpCas9, connected by a flexible XTEN linker, without promoterDepositorInsertCas9
UseCRISPRTagsTREX2Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-AtEXO1B-N
Plasmid#244023PurposeGateway entry plasmid (attL1& attR5) expressing AtEXO1B exonuclease fused to the N-terminus of zSpCas9, connected by a flexible XTEN linker, without promoterDepositorInsertCas9
UseCRISPRTagsAtEXO1BAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2xNES-FRB-ZFPTS2-3xFLAG-2xNLS
Plasmid#107303PurposeExpresses ZFP-VEGFA-TS2 fused to FRB in mammalian cellsDepositorInsertZFP_VEGFA-TS2
UseCRISPRTags2xNES, 3x Flag, 2xNLS, and FRBExpressionMammalianPromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2xNES-FRB-ZFPTS3-3xFLAG-2xNLS
Plasmid#107304PurposeExpresses ZFP-VEGFA-TS3 fused to FRB in mammalian cellsDepositorInsertZFP_VEGFA-TS3
UseCRISPRTags2xNES, 3x Flag, 2xNLS, and FRBExpressionMammalianPromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only