We narrowed to 11,379 results for: ENA
-
Plasmid#186708PurposeN-terminal His-tagged CYP110D1 coding sequence under the control of PpsbA2* promoter and the BBa_B0032 RBS, for the expression in Synechocystis.DepositorInsertalr4766
UseSynthetic BiologyTagsHis-Tag (6His)PromoterPpsbA2*Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251::Ptrc.x.tetO2::B0032::CYP110D1 N-terminal His-Tag
Plasmid#186710PurposeN-terminal His-tagged CYP110D1 coding sequence under the control of Ptrc.x.tetO2 promoter and the BBa_B0032 RBS, for the expression in Synechocystis.DepositorInsertalr4766
UseSynthetic BiologyTagsHis-Tag (6His)PromoterPtrc.x.tetO2Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET303-ColE1-TR-del1-40
Plasmid#180236PurposeExpresses T and R domains of Colicin E1 with N-terminal 40 residue deletion (residues 41-364)DepositorInsertColicin E1
Tags6x His-tagExpressionBacterialMutationTruncation of ColE1 containing T and R domains (r…PromoterT7Available SinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET303-ColE1-T-P110A
Plasmid#180237PurposeExpresses T domain of Colicin E1 (residues 1-190) with proline to alanine mutation at residue 110DepositorInsertColicin E1
Tags6x His-tagExpressionBacterialMutationTruncation of ColE1 containing T domain of ColE1 …PromoterT7Available SinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
iLID-mRuby3-iTrkA
Plasmid#136510PurposeMammalian expression of iLID fused to mRuby3 and intracellular signaling domain of TrkA (aa 450-799)DepositorAvailable SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
iLID-mRuby3-iTrkB
Plasmid#136511PurposeMammalian expression of iLID fused to mRuby3 and intracellular signaling domain of TrkB (aa 455-822)DepositorInsertiLID mRuby3 iTrkB
ExpressionMammalianPromoterCMVAvailable SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmGe1_944-1354-V5His6_D
Plasmid#146136PurposeInsect Expression of DmGe1_944-1354DepositorInsertDmGe1_944-1354 (Ge-1 Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmCup_C
Plasmid#146064PurposeInsect Expression of DmCupDepositorInsertDmCup (cup Fly)
ExpressionInsectMutationTwo silent mutations compared to the sequence giv…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only