We narrowed to 42,759 results for: Ina
-
Plasmid#47735PurposeExpresses enzymatically monobiotinylated full-length MSP7 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP7
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
HcRed-pcw107-V5
Plasmid#64647Purpose(control) when used to produce lentivirus, express physiological levels of insertDepositorInsertn/a
UseLentiviralTagsV5PromoterPGKAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sema3f(L,+)-AP-His
Plasmid#72021PurposeExpresses the Sema3F protein (truncated at cleavage site P3; ie, long and contains no deletion in exon 3), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOCC175
Plasmid#118890Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal HIS6-MBP tag, cleavable with 3C, and N-terminal monomeric GFP, cleavable with TEVDepositorInsertNcoI-HIS6-MBP-3C-mGFP-TEV-NotI-ccdB-AscI-stop-HindIII cassette
TagsHIS6-MBP, cleavable with 3C protease; mGFP, cleav…ExpressionInsectPromoterpolHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSP5-bio
Plasmid#47718PurposeExpresses enzymatically monobiotinylated full-length MSP5 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP5
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
LAP2-beta-actin in modified pEGFP
Plasmid#34839DepositorAvailable SinceFeb. 1, 2012AvailabilityAcademic Institutions and Nonprofits only -
SI16-Kit a
Plasmid#58948Purposeexpresses recombinant mouse anti-Kit a receptor (zebrafish) IgG1 antibody in mammalian cellsDepositorAvailable SinceDec. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEX nsp1 R99A CoV2
Plasmid#175515PurposeFor protein expression of R99A nsp1 CoV2DepositorInsertR99A nsp1 CoV2
TagsGST tagExpressionBacterialPromotertac promoterAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
RhopH3-bio
Plasmid#47781PurposeExpresses enzymatically monobiotinylated full-length RhopH3 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RhopH3
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
L-YARS2-9
Plasmid#166533PurposescFv of a human scaffold targeting Tyrosyl-tRNA synthetase 2, mitochondrial. Antigen coverage aa 31-477 of 477DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOCC120
Plasmid#118892Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal MBP tag, cleavable with 3C, and C-terminal monomeric GFP and HIS6, cleavable with TEVDepositorInsertNcoI-MBP-3C-NotI-ccdB-AscI-mGFP-3C-HIS6-stop-HindIII cassette
TagsMBP, cleavable with 3C protease and mGFP, HIS6, c…ExpressionInsectPromoterpolHAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFPm-DAD M1041A
Plasmid#25411DepositorInsertDiap3 (Diaph3 Mouse)
TagsEGFP, His, and MycExpressionMammalianMutationAlanine substitution at critical residue in DAD t…Available SinceOct. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLXSN-FLK1 TM
Plasmid#65249PurposeExpression of dominant negative FLK1 in mammalian cellsDepositorInsertFLK1 TM (Kdr Mouse)
UseRetroviralExpressionMammalianMutationdeleted AA 786-1346PromoterLTRAvailable SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-Strep/HA-UBE2QL1
Plasmid#124665PurposeExpresses UBE2QL1 with N-terminal Strep-HA tag in mammalian cellsDepositorAvailable SinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
Sema4f.b-Fc-His
Plasmid#72159PurposeExpresses the extracellular region of the Sema4F, isoform b protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUAST-SIK3 K70M
Plasmid#52973Purposeinsect expression of SIK3 K70M (kinase dead mutant)DepositorAvailable SinceMay 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
O-MARS-11
Plasmid#166541PurposescFv of a human scaffold targeting Methionyl-tRNA synthetase. Antigen coverage aa 1-225 of 900DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
Sema5a-AP-His
Plasmid#72035PurposeExpresses the extracellular region of the Sema5A protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only