We narrowed to 8,598 results for: reporter
-
Plasmid#250275PurposeRatiometric protein stability reporter for measuring C-terminal degron activity.DepositorInsertEGFP-GOPC(C-term)
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJC2741 - hPGK-EGFP-CycD1(C-term)-IRES2-mCherry-EF1A-Puro
Plasmid#250272PurposeRatiometric protein stability reporter for measuring C-terminal degron activity.DepositorInsertEGFP-CycD1(C-term)
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSRG12 (eft-3p::24xGCN4::t2a::tagbfp::h2b::tbb-2 3’UTR)
Plasmid#245120PurposeSunTag reporter for live imaging of translation (when combined with scFv::GFP expression) in C. elegansDepositorInsertseft-3p
24xGCN4
T2A
TagBFP (GLO)
H2B
tbb-2 3'UTR
right recombination arm MosSCI cxTi10816
Left recombination arm MosSCI cxTi10816
ExpressionBacterial and WormAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
(203-bp-DIAL-YB_TATA)-mCherry-HRasG12V-BGH_pKG2744
Plasmid#246340Purpose203-bp DIAL Reporter Plasmid with YB_TATA expressing mCherry-GS-HRasG12V in the presence of ZFa and editable by Cre recombinaseDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Rox-nlsKate5V-stop-Rox-myr-Flag-BFP-NEO (JDW 473)
Plasmid#242587PurposeA CAGGS driven, Dre recombinase dependent switch reporter (nls-mKate2 to MbBFP following Dre recombination).DepositorInsertnlsKateV5, MbBPF-FLAG, FRTNeoFRT
ExpressionMammalianPromoterCAGGSAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(WT)-mascRNA(mut 8356-8370)](pAVA3874)
Plasmid#239353PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of MALAT1 ENE(WT)-mascRNA(mut 8356-8370) reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA(mut 8356-8370)
ExpressionMammalianMutationMALAT1 ENE(WT)-mascRNA(mut 8356-8370: ctacgaccacc…Available SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(C8351G)-mascRNA(mut 8356-8370)](pAVA3871)
Plasmid#239352PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of MALAT1 ENE(C8351G)-mascRNA(mut 8356-8370) reporter.DepositorInsertMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370)
ExpressionMammalianMutationMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370: ctacgac…Available SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRAF-V600E-IRES-mCherry
Plasmid#221026PurposeFluorescent reporter for expressing a segment of BRAF-V600E CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRAF-WT-IRES-mCherry
Plasmid#221027PurposeFluorescent reporter for expressing a segment of wild type BRAFDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSA358_pAAV-SCP1-Intron-eGFP-CS1
Plasmid#215513PurposeSingle stranded AAV eGFP reporter vector with SCP1 promoter.DepositorInserteGFP
UseAAVExpressionMammalianPromoterSCP1Available SinceAug. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-DIO-ExRai-AKAR2-T/A
Plasmid#171847PurposeCre-dependent, synapsin promoter-driven expression of the negative control phosphomutant ExRai-AKAR2 T/A PKA biosensor in neurons.DepositorInsertExRai-AKAR2 T/A
UseAAVExpressionMammalianMutationT6A phospho-deficient mutationPromoterhSyn1Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-CMV-mCherry-1xU6-LeuIGI1
Plasmid#217367PurposeExpresses E. coli leucine tRNA variant "LeuIGI1" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli leucine tRNA mutant, "LeuIGI1" for TAG suppression
UseAAVExpressionMammalianMutationG6U, C78G, U83CPromoterU6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-CMV-mCherry-1xU6-LeuIGI2
Plasmid#217368PurposeExpresses E. coli leucine tRNA variant "LeuIGI2" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli leucine tRNA mutant, "LeuIGI2" for TAG suppression
UseAAVExpressionMammalianMutationC2G, C3G, G6U, A7G, U77C, C78G, G81C, G82C, U83CPromoterU6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-FLAG-HAND1-T2A-mTagBFP2
Plasmid#223192PurposeEntry vector containing FLAG-HAND1 with a T2A-mTagBFP2 reporter (attL flanked)DepositorInsertHAND1 (HAND1 Human)
UsePromoterless entry vector for gateway cloningTagsFLAG and T2A-mTagBFP2ExpressionBacterialPromoterNoneAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-Luciferase-P2A-H2A-mCherry (JDW 1129)
Plasmid#229823PurposeA CAGGS driven luciferase reporter followed by a P2A cleavage peptide and an H2A mCherry cassette for nuclear labeling.DepositorInsertLuciferase-P2A-H2A-mCherry
ExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-Tet-Off_FLEX_Luc-P2A-H2A-mCherry (JDW 970)
Plasmid#229824PurposeA PiggyBac vector with a cre-dependent dual luciferase / nuclear mCherry reporter. In the presence of cre, this tet-off vector will be ubiquitously expressed in the absence of dox/tetDepositorInsertLuciferase-P2A-H2A-mCherry
ExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4TO T21R-F8.2 (S54L+T127A)-T2A-mCherry
Plasmid#225584PurposeMammalian expression vector for Doxycycline inducible expression of TRIM21 RING-F8.2(S54L+T127A) anti-tau degrader with a self-cleaving T2A-mCherry fluorescent expression reporterDepositorInsertT21R-F8.2 (S54L+T127A)-T2A-mCherry
TagsmCherryExpressionMammalianMutationT21R-F8.2 (S54L+T127A)PromoterCMVAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA E45A
Plasmid#217438PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with E45A mutation in CA).DepositorInsertgag/pol
UseLentiviralMutationCA E45AAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA Q63/67A
Plasmid#217439PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with Q63A,Q67A mutations in CA).DepositorInsertgag/pol
UseLentiviralMutationCA Q63A,Q67AAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only