We narrowed to 12,280 results for: shRNA
-
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-1
Plasmid#177781PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-2
Plasmid#177782PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA893 - pBA904 Puro-T2A-BFP KLF5 g1 CRISPRa guide guide (pRCA594 backbone) 666
Plasmid#238186PurposeLentiviral CRISPR guide vector expressing a KLF5 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Non-Targeting
Plasmid#241026PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of a non-targeting sgRNA; used as control for SaCas9 based knock-outs in murine astrocytesDepositorInsertU6 driven empty sgRNA
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_RPPH1 (pAVA3586)
Plasmid#239328PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPPH1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPPH1 (RPPH1 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_POP1 (pAVA3497)
Plasmid#239311PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting POP1DepositorInsertU6-driven sgRNA targeting POP1 (POP1 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP38 (pAVA3523)
Plasmid#239313PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP38DepositorInsertU6-driven sgRNA targeting RPP38 (RPP38 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP29 (pAVA3545)
Plasmid#239314PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP29DepositorInsertU6-driven sgRNA targeting RPP29 (POP4 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP20 (pAVA3546)
Plasmid#239316PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP20DepositorInsertU6-driven sgRNA targeting RPP20 (POP7 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP14 (pAVA3507)
Plasmid#239317PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP14DepositorInsertU6-driven sgRNA targeting RPP14 (RPP14 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP30 (pAVA3573)
Plasmid#239318PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP30DepositorInsertU6-driven sgRNA targeting RPP30 (RPP30 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP25 (pAVA3522)
Plasmid#239320PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP25DepositorInsertU6-driven sgRNA targeting RPP25 (RPP25 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 Neo-MORC3_gRNA_1
Plasmid#235529PurposegRNA against human MORC3DepositorInsertMORC3 (MORC3 Human)
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only