-
Plasmid#58955PurposeHIV-1 transfer vector, encodes firefly luciferase gene interrupted by a gamma-globin intron. The reporter gene is silent in the transfected cells and expressed in the infected cells.DepositorInsertinLuc
UseLentiviralTagsExpressionMutationPromoterCMVAvailable sinceSept. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCRU5HT1-inLuc
Plasmid#58954PurposeHTLV-1 transfer vector that encodes firefly luciferase gene interrupted by a gamma-globin intron. The reporter gene is transduced only after the completion of viral cycle replication.DepositorInsertinLuc
UseRetroviralTagsExpressionMutationPromoterCMV/R/U5Available sinceSept. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-olig1
Plasmid#192744PurposeGateway entry vector encoding zebrafish olig1DepositorInsertolig1 (olig1 Zebrafish)
UseGateway entry vectorTagsExpressionMutationF106LPromoterNoneAvailable sinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-sCAG-eGFP-RAB11
Plasmid#203799PurposeAAV vector plasmid expressing human RAB11 fused to eGFP under a short variant of the CAG (sCAG) promoterDepositorInsertRAB11 (RAB11A Human)
UseAAVTagseGFPExpressionMammalianMutationPromoterAvailable sinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-TdTomato-RAB11
Plasmid#203732PurposeAAV vector plasmid expressing human RAB11 fused to TdTomato under the human synapsin (SYN) promoterDepositorInsertRAB11 (RAB11A Human)
UseAAVTagsTdTomatoExpressionMammalianMutationPromoterHuman synapsin promoterAvailable sinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-eGFP-RAB11
Plasmid#203731PurposeAAV vector plasmid expressing human RAB11 fused to eGFP under the human synapsin (SYN) promoterDepositorInsertRAB11 (RAB11A Human)
UseAAVTagseGFPExpressionMammalianMutationPromoterHuman synapsin promoterAvailable sinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-nrip1b
Plasmid#192732PurposeGateway entry vector encoding zebrafish nrip1bDepositorInsertnrip1b (nrip1b Zebrafish)
UseGateway entry vectorTagsExpressionMutationL661P (rs511527097); S720P; A801T; K862E; A863P; …PromoterNoneAvailable sinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
pDONR221-dyrk1aa
Plasmid#192741PurposeGateway entry vector encoding zebrafish dyrk1aaDepositorInsertdyrk1aa (dyrk1aa Zebrafish)
UseGateway entry vectorTagsExpressionMutationPromoterNoneAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj6
Plasmid#192725PurposeGateway entry vector encoding zebrafish kcnj6DepositorInsertkcnj6 (kcnj6 Zebrafish)
UseGateway entry vectorTagsExpressionMutation5' insertion of ATGGCCAAGCTGACAGAATCC, ident…PromoterNoneAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR223 Rab11A WT-STOP
Plasmid#228030PurposeDONR vector for shuttling Rab11A WT into DEST vector. Contains a STOP codon.DepositorInsertRab11A (RAB11A Human)
UseGateway donrTagsExpressionMutationPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CALU-WPRE-UbC-mCherry
Plasmid#225952PurposeLentiviral vector plasmid expressing human calumenin (CALU) under the spleen focus-forming virus (SFFV) promoter and mCherry under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsExpressionMammalianMutationPromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBigTB
Plasmid#149432Purposeshuttle vector with blasticidin-S resistance into ROSA26 targetting vectorsDepositorTypeEmpty backboneUseCre/Lox and Mouse TargetingTagsExpressionMammalianMutationPromoterSV40Available sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CALU-WPRE-UbC-Emerald
Plasmid#225951PurposeLentiviral vector plasmid expressing human calumenin (CALU) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsExpressionMammalianMutationPromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-appa
Plasmid#192745PurposeGateway entry vector encoding zebrafish appaDepositorInsertappa (appa Zebrafish)
UseGateway entry vectorTagsExpressionMutationS47NPromoterNoneAvailable sinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR223 Rab11A S25N-STOP
Plasmid#228032PurposeDONR vector for shuttling Rab11A S25N (Dominant negative mutation) into DEST vector. Contains a STOP codon.DepositorInsertRab11A (RAB11A Human)
UseGateway donrTagsExpressionMutationS25NPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR223 Rab11A Q70L-STOP
Plasmid#228033PurposeDONR vector for shuttling Rab11A Q70L (constitutively active mutation) into DEST vector. Contains a STOP codon.DepositorInsertRab11A (RAB11A Human)
UseGateway donrTagsExpressionMutationQ70LPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR223 Rab11A S20V-STOP
Plasmid#228031PurposeDONR vector for shuttling Rab11A S20V (constitutively active mutation) into DEST vector. Contains a STOP codon.DepositorInsertRab11A (RAB11A Human)
UseGateway donrTagsExpressionMutationS20VPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-kcnj13
Plasmid#173143PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj13 (kcnj13 Zebrafish)
UsePcr cloning vectorTagsExpressionMutationPromoterNo promoter at 5 end; T7 promoter at 3 end.Available sinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only