We narrowed to 24,448 results for: promoter
-
Plasmid#170069PurposeExpresses S. pyogenes CRISPR chimeric RNA element (with F+E modifications) with customizable gRNA from U6 promoter and puromycin resistance from EFS-NS promoterDepositorInsertCas9 guide RNA scaffold with the F+E scaffold modification
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPV-TetO-SpCas9-GR-iC-ERiH (CRONUS-Hygro)
Plasmid#100597PurposepiggyBac vector expressing Dual-regulated Cas9 (Hygro resistance)DepositorInsertsCRISPR Cas9 fused with human Glucocorticoid Receptor
mCherry
rtTA-M2
UsePiggybac vectorExpressionMammalianMutationCodon-optimized for human codon usagePromoterDox-inducible TetO promoter and Human EEF1A1 prom…Available SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpG-HF1-P2A-EGFP (RTW5000)
Plasmid#139996PurposeCMV and T7 promoter expression plasmid for human codon optimized SpG-HF1(SpG=D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R;HF1=N497A/R661A/Q695A/Q926A) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9 variant named SpG-HF1 with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpG=D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R; HF…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Myc2- Hs TTP WT
Plasmid#107008PurposeExpresses epitope-tagged wild-type human TTPDepositorAvailable SinceMarch 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV-EF1aGFP2AKAT7(E508Q)-W
Plasmid#159293PurposeLentiviral vector expressing GFP and KAT7 (gRNA-resistant, E508Q mutant) driven by human EF1a promoterDepositorInsertKAT7 E508Q
UseLentiviralExpressionMammalianMutationCRISPR sites mutated (gRNA ID. 5 and A10) and E50…Promoterhuman EF1a promoterAvailable SinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-BAZ1B
Plasmid#65372PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ucp1-Cre-miR122
Plasmid#228408PurposeExpression of Cre recombinase from a rat Ucp1 enhancer-promoter. Contains miR122 target sequences that suppress expression in hepatocytes.DepositorInsertscre recombinase with SV40 NLS
Cre recombinase with SV40 NLS
UseAAVPromoterrat Ucp1 enhancer-promoterAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRDT
Plasmid#65381PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-PDGFRA-reporter
Plasmid#136456PurposeMammalian fluorescent reporter plasmid for PDGFRA signaling.DepositorInsertsPDGFRalpha (PDGFRA Human)
Array of serum response elements (SRE) to drive destabilized GFP expression from a minimal promoter.
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianPromoterCMV and Minimal promoter with artificial SRE enha…Available SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX307 HRAS
Plasmid#117748PurposeOpen reading frame vector encoding HRASDepositorInsertRASH1 (HRAS Human)
UseLentiviralTagsV5ExpressionMammalianMutationClosed vector so will not read through the V5 reg…PromoterEF1aAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-pdh_RiboJ_mCherry_Bba_B0015
Plasmid#107581PurposeB. megaterium DSM319 pdh promoter, mCherry (Bacillus codon optimised) for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertmCherry
UseSynthetic BiologyExpressionBacterialPromoterpdh promoter Bacillus megaterium DSM319Available SinceApril 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-GCN5
Plasmid#65386PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC7
Plasmid#231656PurposeExpresses human ZDHHC7 proteinDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC3
Plasmid#231652PurposeExpresses human ZDHHC3 proteinDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 1
Plasmid#51760PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 1
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
PB-3XpolyA-3XPC-miniCMV-mCherry-WPRE-insulator
Plasmid#168291Purposeoptimized miniCMV (OminiCMV)DepositorInsertmCherry
ExpressionMammalianPromoterminiCMVAvailable SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORTMAGE311B
Plasmid#120418PurposeExpresses Lambda Beta and a dominant negative MutL E32K allele, controlled by XylS-Pm expression system for high precision and efficient MAGE experiments at 37°C. RSF1010 Ori; Broad host-range; KanRDepositorArticleInsertsMutL E32K
Lambda Beta
XylS
ExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…PromoterPmAvailable SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only