We narrowed to 21,140 results for: ACE;
-
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only
-
PvLEA4_repeats_k3_26_mCh-SspB (pBS1075)
Plasmid#185299PurposeMammalian expression of sleeping chironomid protein PvLEA4_repeats_k3_26 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertpvLEA22mer_shuffle_3
ExpressionMammalianAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
DHN_VrDHN1a_mCh-SspB (pBS1074)
Plasmid#185298PurposeMammalian expression of riverbank grape plant protein DHN_VrDHN1a attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertPvLEA4_repeats_k3_26
ExpressionMammalianAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_shuffle_3_mCh-2xFKBP (pBS1119)
Plasmid#185314PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_shuffle_3 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertpvLEA22mer_shuffle_3
ExpressionMammalianAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_APOE_HUMAN_A234G (pBS0816)
Plasmid#185267PurposeFor the mammalian expression of the human protein APOE_HUMAN_A234G. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAPOE_HUMAN_A234G
ExpressionMammalianMutationA234GAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_Q19228_CAEEL_93-127 (pBS0735)
Plasmid#185231PurposeFor the mammalian expression of the C. elegans protein Q19228_CAEEL_93-127. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertQ19228_CAEEL_93-127
ExpressionMammalianAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_D4NWF2_DrHD_b03_dom3 (pBS0681)
Plasmid#185207PurposeFor the mammalian expression of the Deinococcus radiodurans protein D4NWF2_DrHD_b03_dom3. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertD4NWF2_DrHD_b03_dom3
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_APOA4_ANDDA_21-367 (pBS0742)
Plasmid#185234PurposeFor the mammalian expression of the Chinese giant salamander protein APOA4_ANDDA_21-367. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAPOA4_ANDDA_21-367
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_Q7JLY3_CAEEL_48-124 (pBS0738)
Plasmid#185232PurposeFor the mammalian expression of the C. elegans protein Q7JLY3_CAEEL_48-124. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertQ7JLY3_CAEEL_48-124
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_Q19228_CAEEL_51-88 (pBS0734)
Plasmid#185230PurposeFor the mammalian expression of the C. elegans protein Q19228_CAEEL_51-88. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertQ19228_CAEEL_51-88
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_Q19228_CAEEL_51-127_noLink (pBS0733)
Plasmid#185229PurposeFor the mammalian expression of the C. elegans protein Q19228_CAEEL_51-127_noLink. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertQ19228_CAEEL_51-127_noLink
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_shuffle_5 (pBS0731)
Plasmid#185228PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_shuffle_5. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_shuffle_5
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_shuffle_3 (pBS0729)
Plasmid#185227PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_shuffle_3. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_shuffle_3
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_shuffle_1 (pBS0727)
Plasmid#185226PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_shuffle_1. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertpvLEA22mer_shuffle_1
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_mutant_5 (pBS0722)
Plasmid#185225PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_5. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_mutant_5
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_mutant_3 (pBS0720)
Plasmid#185224PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_3. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertpvLEA22mer_mutant_3
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_mutant_23 (pBS0719)
Plasmid#185223PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_23. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_mutant_23
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_mutant_22 (pBS0718)
Plasmid#185222PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_22. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertpvLEA22mer_mutant_22
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_mutant_21 (pBS0717)
Plasmid#185221PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_21. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_mutant_21
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_mutant_2 (pBS0715)
Plasmid#185220PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_2. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_mutant_2
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only