We narrowed to 14,607 results for: sta
-
Plasmid#35978DepositorInserttransactivating protein (tat Human Immunodeficiency Virus)
UseRNAi and RetroviralTagsFlagExpressionMammalianMutationFrom the "E" HIV cladeAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-BI16-FLAG-3C-ORF1_mClover3-TEV-ORF2
Plasmid#105801PurposeConcomitant expression of two proteins. One protein expressed with FLAG, cleavable by 3C or enterokinase; second protein expressed with mClover3, cleavable by TEV protease; tags positions: N-termini.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: FLAG-3C; ORF2: mClover3-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cx43K258stop-msfGFP
Plasmid#69023PurposeExpresses rat Cx43 (Gja1 CDS) truncated at amino acid 258 and tagged with msfGFP on the C-terminus. CMV promoter.DepositorInsertCx43 (Gja1 Rat)
TagsV206K monomerized super folder GFPExpressionMammalianMutationdelete codons 258-381 and fuse in frame to monome…PromoterCMVAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-eGFP-Ofd1-Myc-G139S
Plasmid#24581DepositorInsertOfd1 (Ofd1 Mouse)
TagsMyc and eGFPExpressionMammalianMutationGlycine 139 changed to serine (codon GGT to AGT)Available SinceJune 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-eGFP-Ofd1-Myc-S437R
Plasmid#24582DepositorInsertOfd1 (Ofd1 Mouse)
TagsMyc and eGFPExpressionMammalianMutationSerine 437 changed to Arginine (codon AGT to CGT)Available SinceJune 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
pFastBac dual_Human full length CDK7(W132R, S164D, T170E)
Plasmid#217013PurposeExpression of CDK7 in insect cellsDepositorInsertCDK7(W132R, S164D, T170E) (CDK7 Human)
TagsTEV cleavable his tagExpressionInsectMutationCDK7(W132R, S164D, T170E)Available SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Arabidopsis thaliana Atm3 d80 pET21a+
Plasmid#173045PurposeExpresses AtAtm3 in E.coliDepositorInsertArabidopsis thaliana Atm3 (ABCB25 Mustard Weed)
Tags6xHis tagExpressionBacterialMutationwith N-terminal 80 amino acids deletionAvailable SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
SLC19A1_pcDNA6.2/EmGFP-Bsd
Plasmid#176951PurposeMammalian expression vector encoding SLC19A1 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
APP_pcDNA6.2/EmGFP-Bsd
Plasmid#176954PurposeMammalian expression vector encoding APP and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCI-TPI_WT-IL6_3UTR-xrRNA-4H
Plasmid#108373PurposeExpresses wild type TPI reporter; contains partial IL6 3' UTR; enables detection of 5'-3' decay intermediates (xrFrag) and allows detection via northern blot (4H binding sites)DepositorInsertExpressionMammalianPromoterCMVAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEG610
Plasmid#40195DepositorInsertMex-5 (aa1-355) (RNAi resistant) (mex-5 Nematode)
TagsDendra2 PAFP (sequence optimized for worm express…ExpressionWormMutationcontains aa 1-355; exon 2 recoded to be RNAi-resi…Promoter4.4 kb mex-5 promoter fragmentAvailable SinceSept. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEG585
Plasmid#40192DepositorInsertMex-5 (S404A) (RNAi resistant) (mex-5 Nematode)
TagsDendra2 PAFP (sequence optimized for worm express…ExpressionWormMutationS404A; exon 2 recoded to be RNAi-resistantPromoter4.4 kb mex-5 promoter fragmentAvailable SinceSept. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA1_D262V-FLAG-IRES-eGFP
Plasmid#234620PurposeMammalian expression of full-length hnRNPA1 D262V with C-terminal FLAG tag co-expressing with eGFP via IRES sequenceDepositorInserthnRNPA1 D262V (HNRNPA1 Human)
TagsFLAGExpressionMammalianMutationFamillial ALS mutation D262V, C-terminal FLAG tag…PromoterCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTT3-ecdCD19-ST3-His_withSUMO
Plasmid#223219PurposeExpression of the extracellular domain of human CD19 fused to Spytag003 + Histag in HEK293(or similar) with SUMO for better protein expressionDepositorInsertextracellular domain of B-lymphocyte antigen CD19 (CD19 Human)
TagsHistag, SUMO, and SpytagExpressionMammalianPromoterCMVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWZL-hygro-FAKY397F
Plasmid#216677PurposeThis retroviral plasmid expresses a mutated cDNA (dominant negative: Y397F) of human PTK2DepositorInsertPTK2 (Y397F) (PTK2 Human)
UseRetroviralTagsNoExpressionMammalianMutationFAK dominant negative mutation Y397FAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET151-D-TOPO-PARP14-SΔK
Plasmid#216658PurposeExpresses multidomain construct of PARP14 with internal SUMO domain (PARP14-SΔK) in bacterial cells.DepositorInsertPARP14-SΔK DNA sequence (PARP14 G784-K1808 with internal SUMO-TEV sequence) (PARP14 Human, Synthetic)
Tags6xHis-V5-TEVExpressionBacterialMutationDeletion starting from Q1390 to D1448 and substit…PromoterT7Available SinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSAD-5PSD95-EGFP-SynPhRFP
Plasmid#217979PurposeG-Deleted Rabies genomic plasmid to express 5PSD95-EGFP and SynPhRFPDepositorUseG-deleted rabiesTagsEGFP and RFPPromoterNoneAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
phROSA26-Tet-HA-JLP_WT
Plasmid#208770PurposeTetracycline inducible expression vector for HA-tagged wild-type JLP protein (HA-JLP_WT), used as a donor plasmid for HA-JLP_WT knock-in at the human ROSA26 locusDepositorInsertJLP (SPAG9 Human)
ExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX-5'-aptamer-tagged-SVA-lncRNA-AK057321-mcherry
Plasmid#202818PurposeLentiviral vector to express 5'-aptamer tagged SVA-lncRNA AK057321 with CMV for mcherry expressionDepositorInsertSVA-lncRNA AK057321
UseLentiviralExpressionMammalianMutationaddition of a dual aptamer RNA tag 5' to the…PromoterU6Available SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only