We narrowed to 9,835 results for: CAG
-
Plasmid#74005PurposegRNA for B108DepositorInsertgRNA
UseCRISPRTagsnonePromoterU6Available sinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
B53
Plasmid#74006PurposegRNA for B108DepositorInsertgRNA
UseCRISPRTagsnonePromoterU6Available sinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_muBim_Ex3
Plasmid#85533PurposeInducible expression of guide RNA (muBim_Ex3) with fluorescent GFP reporterDepositorInsertmu Bim
PromoterH1tAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
c7-87/199_HLL
Plasmid#63122PurposeMm-cpn cysteine double mutant for crosslinkingDepositorInsertMm-cpn c7_87/199_HLL (NEWENTRY )
Tags6x HIS-tagExpressionBacterialMutationC140S-C237S-C286A-C359T-C393A-C470S-C484S-K87C-S1…Available sinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-ATF7IPi1
Plasmid#59614PurposeExpression of shRNA against human ATF7IPDepositorAvailable sinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
TRbeta shRNA #1
Plasmid#32620DepositorPublicationInsertTRbeta shRNA #1 (THRB Chicken)
UseRNAiAvailable sinceJuly 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
phSyn-Xph20-eGFP-CCR5TC
Plasmid#255756Purposep-ZFB-Syn-Xph20-eGFP-CCR5TC: PSD-95 intrabody (Xph20) fused to eGFP with a CCR5 zinc finger for labelling the postsynaptic density.DepositorInsertXph20
ExpressionMammalianPromoterhSynAvailable sinceAug. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX601-Nlgn2-gRNA2-GfaABC1D-mCherry
Plasmid#250933PurposeNlgn2 gRNA #2 targeting Rat Nlgn2. Also expresses SaCas9 T2a mCherry under the astrocyte promoter gfaABC1DDepositorAvailable sinceJune 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ60) AAV: U6-gRNA(cs1)-EF1a-eGFP
Plasmid#254582PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and capture sequence in scaffold and eGFP from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable sinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ318) AAV: U6-gRNA(FLEX)-EF1a-mScarlet
Plasmid#254587PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and 10x FLEX preferred scaffold and mScarlet from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ320) AAV: U6-gRNA(FLEX)-EF1a-ZsGreen
Plasmid#254588PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and 10x FLEX preferred scaffold and ZsGreen from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ76) AAV: U6-gRNA(cs1)-EF1a-mCherry
Plasmid#254583PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and capture sequence in scaffold and mCherry from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B-PtALSgRNA
Plasmid#245880PurposeGolden gate entry vector carrying the gRNA for base editing in Poplar hybrid ALS geneDepositorInsertPtALSgRNA
UseCRISPRExpressionPlantPromoterAtU3Available sinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
DBJS-p2.16
Plasmid#246893PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid encoding guide for CAPRIN1 Nterm.DepositorInsertCaprin1 Nterm Guide RNA 1 (CAPRIN1 Human)
ExpressionMammalianAvailable sinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
1197R_gZBF-ER
Plasmid#241825PurposegRNA expressing plasmid with broken SEPARATORDepositorInsertActin5C promoter
UseCRISPRExpressionInsectAvailable sinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459_LIG4_Exon3
Plasmid#225363PurposepX459 plasmid encoding the sgRNA protospacer sequence “5’-GCATAATGTCACTACAGATC-3’ to target the LIG4 gene.DepositorAvailable sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmEmerald_mEmerald_I3
Plasmid#231681PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with two tandem mEmeralds in mammalian cells. Assembles into nanocages tagged with 120 mEmerald FPs.DepositorInsertI3-01
TagsmEmeraldExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmEmerald_I3
Plasmid#231680PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with one mEmerald in mammalian cells. Assembles into nanocages tagged with 60 mEmerald FPs.DepositorInsertI3-01
TagsmEmeraldExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-TO-g0 (FLP-IN)
Plasmid#236120PurposePlasmid encoding g0 guide RNA under control of CMV promoter with two TetR binding sites, used to equalize plasmid masses for transfectionDepositorInsertg0
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable sinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only