We narrowed to 10,409 results for: SEC
-
Plasmid#37738DepositorAvailable SinceNov. 20, 2012AvailabilityAcademic Institutions and Nonprofits only
-
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_cpaA- Pconstitutive-sgRNA(Sth3)_blaA
Plasmid#133347Purposeexpression of two sgRNA from Streptococcus thermophilus #3 each express from its own constitutive promoter; here first one targets cpaA and second one targets blaA (from Caulobacter crescentus)DepositorInsertsgRNA_cpaA and sgRNA_blaA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJ02B2Gm:Rm_AF
Plasmid#66061PurposeMoClo Device: FACS Standard Color Controls - High GFP (first unit) & RFP (second unit) expression cassette - Ampicillin plasmid [A:J23102:B:BCD2:C:E0040m:D:B0015:E:J23102:B:BCD2:C:E1010m:D:B0015:F]DepositorInsertFACS Controls
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJ02B2Rm:Gm_AF
Plasmid#66062PurposeMoClo Device: FACS Standard Color Controls - High RFP (first unit) & GFP (second unit) expression cassette - Ampicillin plasmid [A:J23102:B:BCD2:C:E1010m:D:B0015:E:J23102:B:BCD2:C:E0040m:D:B0015:F]DepositorInsertFACS Controls
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pP[RS3]3'M
Plasmid#53552Purposefor an easy screen of TALEN- and CRISPR/Cas9- mediated mutagenesis in DrosophilaDepositorInsertAscI and MluI restriction enzyme sites
ExpressionInsectPromotersame pP[RS3]Available SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUASt-FMW-attB-AthHen1
Plasmid#104958PurposeExpression of FLAG Myc tagged A.thaliana-Hen1 (codon optimised for Drosophila) in Drosophila using somatic tissue Gal4 driversDepositorAvailable SinceJan. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUASP YFP Rab32 DN
Plasmid#37739DepositorInsertRab32 (Rab32 Fly)
UseDrosophilaTagsYFPExpressionInsectMutationT33N (dominant negative)PromoterGAL4Available SinceNov. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
GTL-ir
Plasmid#81102PurposeGene Tagging vector LEU/iRFP - Plasmid for tandem infrared RFP (tdiRFP) labeling of endogenous proteins with a LEU selection marker, originating from pSIVl (ID:81090)DepositorInserttdiRFP
UseCre/LoxTagstdiRFPExpressionYeastMutationcodon optimized second iRFP to avoid internal rec…Available SinceNov. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
Djun - antisense
Plasmid#38338DepositorAvailable SinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
pUASp YFP Rab32 CA
Plasmid#37740DepositorInsertRab32 (Rab32 Fly)
UseDrosophilaTagsYFPExpressionInsectMutationQ79L (constitutive active)PromoterGAL4Available SinceNov. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-His-Flag-Tipin-L195A
Plasmid#23120DepositorInsertTipin (TIPIN Human)
TagsFlag- and HisExpressionInsectMutationChanged Leucine 195 to AlanineAvailable SinceMarch 3, 2010AvailabilityAcademic Institutions and Nonprofits only -
BacPAK Flag-Adrm1
Plasmid#19419DepositorAvailable SinceNov. 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-His-Tipin-L195A
Plasmid#23121DepositorAvailable SinceMarch 3, 2010AvailabilityAcademic Institutions and Nonprofits only -
pADH100Cau
Plasmid#244817PurposeModified plasmid from pADH100 to perform HIS-FLP CRISPR in Candidozyma aurisDepositorInsertSNR52p from C. auris
UseCRISPRTagsHIS1 terminator from C. auris and NAT resistance …ExpressionYeastPromoterSNR52pAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX458 BLTP3A knockout
Plasmid#241256PurposeKnock-out plasmid targeting the second exon of human BLTP3A (UHRF1BP1)DepositorInsertBLTP3A (UHRF1BP1) KO gRNA (BLTP3A Human)
ExpressionMammalianAvailable SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPIC9K_A2AR_316_V229C_R293A
Plasmid#246918PurposeExpress A2AR mutants in Pichia PastorisDepositorInsertAdenosine A2A receptor (ADORA2A Human)
Tags10xHis and alpha-factor secretion signal, FLAGExpressionYeastMutationtruncated to aa 1-316, V229C, R293APromoterAOX1Available SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPIC9K_A2AR_316_V229C_R291AR293A
Plasmid#246919PurposeExpress A2AR mutants in Pichia PastorisDepositorInsertAdenosine A2A receptor (ADORA2A Human)
Tags10xHis and alpha-factor secretion signal, FLAGExpressionYeastMutationtruncated to aa 1-316, V229C, R291A, R293APromoterAOX1Available SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only