We narrowed to 17,819 results for: Mut
-
Plasmid#147732PurposeMammalian Expression of HsNot1iso2-6xmutDepositorInsertHsNot1iso2-6xmut (CNOT1 Human)
UseTagsExpressionMammalianMutation4 silent and two non silent G917E and R2353Q muta…PromoterAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmGW182-10xmut_G
Plasmid#146428PurposeInsect Expression of DmGW182-10xmutDepositorInsertDmGW182-10xmut (gw Fly)
UseTagsExpressionInsectMutationMultiple mutations compared to NM_166780.1, see a…PromoterAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRTagsExpressionMutationS264A, and silent mutation to remove PAM sitePromoterAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMOD4-mT2A-mutated_rpsL-BSD-F
Plasmid#182338PurposeTemplate plasmid for PCR amplification of initial recombineering cassetteDepositorInsertBSD
UseMouse Targeting; Flp / frtTagsExpressionBacterialMutationPromoterAvailable SinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsC2orf68-EBMmut_K
Plasmid#146761PurposeMammalian Expression of HsC2orf68-EBMmutDepositorAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsDCP1a-mut1_G
Plasmid#146415PurposeMammalian Expression of HsDCP1a-mut1DepositorAvailable SinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-Fluc-nanos-SRE2mut_C
Plasmid#146021PurposeInsect Expression of nanos-3UTR-SRE2mtDepositorAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-Fluc-oskar-SRE1mut_C
Plasmid#146023PurposeInsect Expression of oskar-3UTR-SRE1mutDepositorAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-Fluc-nanos-SRE1,2mut_C
Plasmid#146019PurposeInsect Expression of nanos3UTR-SRE1,2mutDepositorAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-Fluc-nanos-SRE1mut_C
Plasmid#146020PurposeInsect Expression of nanos-3UTR-SRE1mutDepositorAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmMe31B-mut1_E
Plasmid#146203PurposeInsect Expression of DmMe31B-mut1DepositorAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
TetO::EGFP-hMeikin(8A mut)
Plasmid#174707PurposeDoxycycline inducible expression of human Meikin with 8 alanine mutations that eliminate Plk1 bindingDepositorInsertMeikin
UseTagsEGFPExpressionMammalianMutationS175A, T176A, T180A, S181A, S196A, T251A, T264A, …PromoterAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#2
Plasmid#173986PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motif #2 mutated
UseLuciferaseTagsExpressionMutationCoordinator motif mutation #2PromoterSV40 promoterAvailable SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_7XCoordinatorMutant
Plasmid#173994PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with all 7 Coordinator motifs mutated
UseLuciferaseTagsExpressionMutation7X Coordinator motif mutation #1-2-3-4-5-6-7PromoterSV40 promoterAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_min1-2_4XCoordinatorMutant
Plasmid#173962PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertMinimal enhancer regions 1 and 2 (min1 and min2) from SOX9 enhancer cluster EC1.45 with 4 mutated Coordinator motifs
UseLuciferaseTagsExpressionMutation4 mutated Coordinator motifsPromoterSV40 promoterAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#1
Plasmid#173985PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motif #1 mutated
UseLuciferaseTagsExpressionMutationCoordinator motif mutation #1PromoterSV40 promoterAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#3
Plasmid#173987PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motif #3 mutated
UseLuciferaseTagsExpressionMutationCoordinator motif mutation #3PromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#5
Plasmid#173989PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motif #5 mutated
UseLuciferaseTagsExpressionMutationCoordinator motif mutation #5PromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_4XCoordinatorMutant#1-2-3-4
Plasmid#173992PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motifs #1, #2, #3 and #4 mutated
UseLuciferaseTagsExpressionMutation4X Coordinator motif mutations #1-2-3-4PromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#6
Plasmid#173990PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motif #6 mutated
UseLuciferaseTagsExpressionMutationCoordinator motif mutation #6PromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only