We narrowed to 19,451 results for: cat
-
Plasmid#208280PurposeExpresses RGG-BcLOV-EGFR for optogenetic activation of EGFR signaling. Includes an mCherry tag.DepositorInsertRGG-BcLOV-mCh-EGFR
UseLentiviralMutationH225N in mCherry- please see depositor commentPromoterpCMVAvailable sinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKB11 (pDEST-DHFR F[1,2] C-term, NatR)
Plasmid#210485PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the C-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available sinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN0605 (pDEST-DHFR F[1,2] N-term, NatR)
Plasmid#210487PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available sinceDec. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FRT-JEDI-1P-Kv-WPRE
Plasmid#202617PurposeGenetically encoded voltage indicator (GEVI) JEDI-1P flanked by FRT in AAV production vector expressed under the mammalian promoter (EF1a), FLP recombinase-dependentDepositorInsertFRT-JEDI-1P-Kv
UseAAV; Flp/frtExpressionMammalianPromoterEF1aAvailable sinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgVRK1
Plasmid#199638PurposeTamoxifen-inducible expression of sgRNA targeting VRK1DepositorPublicationInsertN/A (VRK1 Human)
UseLentiviralAvailable sinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTS102 pHAGE2 CMVtetO2 TagBFP-P2A-ALFA-22xGS-SUMOstar-MCS
Plasmid#199355PurposeLentiviral transfer plasmid for doxycycline inducible expression of a N-terminally BFP-P2A-ALFA-SUMOstar-tagged protein in mammalian cells.DepositorTypeEmpty backboneUseLentiviralTagsTagBFP-P2A-ALFA-SUMOstarExpressionMammalianMutationWTAvailable sinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTS112 pHAGE2 CMVtetO2 MCS-TEV-22xGS-Alfa-P2A-TagBFP
Plasmid#199365PurposeLentiviral transfer plasmid for doxycycline inducible expression of a C-terminally TEV-ALFA-P2A-BFP-tagged protein in mammalian cells.DepositorTypeEmpty backboneUseLentiviralTagsTEV-ALFA-P2A-TagBFPExpressionMammalianMutationWTAvailable sinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Notch1 #1 GFP
Plasmid#106950PurposeLentivirus encoding sgRNA targeting murine Notch1. Includes GFP marker.DepositorAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_hph
Plasmid#184919PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_hph recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pet15b-Internalization and Endosomal Escape
Plasmid#186551PurposeInternalization and Endosomal Escape to effectively route a protein cargo to the cytosol of cellsDepositorInsert10R-8His-ETA-EGFP
Tags8xHis and EGFPExpressionBacterialPromoterT7Available sinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET303-ColE1-T-E192C
Plasmid#180233PurposeExpresses T domain of Colicin E1 (residues 1-190) with C terminal cysteine for maleimide chemistryDepositorInsertColicin E1
Tags6x His-tagExpressionBacterialMutationTruncation of ColE1 containing T domains (residue…PromoterT7Available sinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
Phage-PGK-GFP-T(WT)
Plasmid#181736Purposefor lentiviral expression of brachyury ORF in mammalian cellsDepositorInsertT (brachyury)
UseLentiviralMutationa silent mutation in the PAM site of an sgRNAt ta…Available sinceAug. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH_ss-SBP-EGFP
Plasmid#172358PurposeReporter to monitoring a streptavidin-binding peptide traffickingDepositorInsertER importing signal sequence
UseLentiviralTagsSBP-EGFPExpressionMammalianPromoterCMVAvailable sinceJune 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTp53#2/Cre
Plasmid#173621PurposeExpresses a Tp53-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Tp53 (Trp53 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pY71-PT7-RiboJ-sfGFP-MGapt
Plasmid#129119PurposeExpresses a fluorescent reporter for the quantification of cell-free protein expression.DepositorInsertSuperfolder GFP with Malachite Green aptamer
UseSynthetic BiologyTagsHis6 and RiboJ InsulatorExpressionBacterialPromoterT7Available sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC234r-ccdB/TPK2
Plasmid#176179Purposeyeast MoClo level-0 part plasmid type 234r containing toxic gene dropout cassette (ccdB and TPK2)DepositorInsertdropout cassette containing toxic genes ccdB and TPK2
UseSynthetic BiologyAvailable sinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pH6HTC_RAN-Halo
Plasmid#175339PurposeProduction of HaloTag fusion proteinDepositorPublicationAvailable sinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
Gfp-rt-vasa
Plasmid#167322PurposePlasmid for synthesis of GFP chimeric RNA that contained vasa-3'UTRs of rainbow trout by in vitro transcription.DepositorInsertrt vasa 3'UTRs (ddx4 rainbow trout)
ExpressionBacterialAvailable sinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMVTCRb_candidate7
Plasmid#165004PurposeExpression of candidate TCR #7 TCRbeta cDNADepositorAvailable sinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only