We narrowed to 18,432 results for: REV
-
Plasmid#231603PurposeExpress circular RNA translation reporter with 1xALFATag-5xSunTag_codon_optimized-4x(6xAAA) under CMV promoterDepositorInsertTornado-1xALFATag-5xSunTag_codon_optimized-4x(6xAAA)
ExpressionMammalianAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAV-CMVp-2xTetO-Tornado-1xALFATag-5xSunTag_codon_optimized+8xAAA
Plasmid#231604PurposeExpress circular RNA translation reporter with 1xALFATag-5xSunTag_codon_optimized-8xAAA under CMV promoterDepositorInsertTornado-1xALFATag-5xSunTag_codon_optimized-8xAAA
ExpressionMammalianAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAV-H1promoter-2xTetO-Tornado-2xALFA-10xSunTag-Pseudoknot
Plasmid#231593PurposeExpress circular RNA translation reporter with 2xALFATag-10xSunTag-Pseudoknot under H1 promoterDepositorInsertTornado-2xALFATag-10xSunTag-Pseudoknot sequence
ExpressionMammalianAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-L1374
Plasmid#226278PurposePlasmid expressing the SSD1 allele from L-1374, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-ATG2A HRD
Plasmid#207540PurposeHomologous recombination donor to integrate a 3xFLAG-HaloTag at the endogenous ATG2A locus in human cellsDepositorInsertHaloTag flanked by human ATG2A locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pAM72
Plasmid#227622PurposepETDuet-1 Rpn8(1-179)-precission-Strep, H6-precission-Rpn11(2-239, G77P)DepositorTagsHis-PrescissionExpressionBacterialMutation1-179 and aa 2-239, G77PPromoterT7Available SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Nuc-deltaCKAR
Plasmid#222430PurposeFRET-based reporter for monitoring deltaPKC activity at the nucleus in cells.DepositorInsertNucleus delta-selective C kinase activity reporter
TagsCFP and YFPExpressionMammalianAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTet-F30-Pepper aptamer-UTR1-mTurq2
Plasmid#227645PurposepTet-driven expression of F30-scaffolded Pepper aptamer and mTurquoise2 for quantifying cell-free RNA and protein synthesis. The mTurq2 has a GGGGS linker followed by a His6x tag.DepositorInsertF30-scaffolded Pepper aptamer and mTurquoise2 (codon optimized for E. coli B using IDT Codon Optimizer)
UseSynthetic BiologyAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM315 pACYC-His6-Rpn10[ΔUIM]
Plasmid#226348PurposeExpression of yeast Rpn10 with the UIM deletedDepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Golgi-deltaCKAR
Plasmid#222428PurposeFRET-based reporter for monitoring deltaPKC activity at the Golgi in cells.DepositorInsertGolgi delta-selective C kinase activity reporter
TagsCFP and YFPExpressionMammalianAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-NCYC110
Plasmid#226273PurposePlasmid expressing the SEC22 allele from NCYC110, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYAMTr2GCsgSeLEU2
Plasmid#224870PurposeDisruption of S. eubayanus type LEU2 genesDepositorInsertpYAMTr2GC having the guide sequence SeLEU2 (DI49_0736 Budding Yeast)
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGFP-AUG-IRES-mCherry
Plasmid#222109PurposeStart codon reporter (WT AUG)DepositorInsertGFP-IRES-mCherry
UseLentiviralAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1559
Plasmid#218590PurposeExpress peroxisomal Idi1p, Erg20(F96W,N127W)p, and GESp to convert IPP to geraniol with cytosolic Erg20 homodimerDepositorInsertGES
TagsePTS1ExpressionYeastMutationErg20(F96W, N127W), Erg20-Erg20 synthetic homodim…Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only