We narrowed to 15,990 results for: nes
-
Plasmid#184816PurposeUsed to generate the Tg(QUAS:GFP-CAAX; he1.1:YFP)c631 transgenic lineDepositorInsertQUAS:GFP-CAAX-pA; he1.1:CFP
UseZebrafish tol2 transgenesisTagsGFP-CAAXAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS84 (U6p::GGACAGTCCTGCCGAGGTGG)
Plasmid#193852PurposeEncodes the guide RNA targeting the sequence GGACAGTCCTGCCGAGGTGGDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
P-BT1763
Plasmid#188111PurposepBolux harboring the promoter region upstream of BT1763DepositorInsertThe B. thetaiotaomicron BT1763 promoter cloned into pBolux
ExpressionBacterialPromoterBT1763Available SinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP230-Lenti-TRE3G-4xMyc-GluN2B(E1479Q)-WPRE-pA
Plasmid#164795PurposepLenti vector backbone designed to express 4XMyc Tagged-GluN2B(E1479Q) from a TRE3G promoter.DepositorInsertGluN2B
UseLentiviralTags4xMycAvailable SinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC_mNG2(11)_BSDminus_F2
Plasmid#184164PurposeDonor cassette plasmid for high-throughput tagging, encoding an mNG2(11) synthetic exon in frame 2, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmNG2(11)
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC_mNG2(11)_BSDminus_F0
Plasmid#184162PurposeDonor cassette plasmid for high-throughput tagging, encoding an mNG2(11) synthetic exon in frame 0, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmNG2(11)
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHWBF06exp
Plasmid#130831PurposeExpression of plant LINC fluorescent fusion protein for cell biologyDepositorInsertSUN2
TagsmCherry-FLAG-HAExpressionPlantPromoterCaMV 35SAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSP64-membrane-mCherry
Plasmid#135598PurposeExpression of membrane-mCherry mRNA for microinjection for visualization of membrane in S. pupuratusDepositorInsertmembrane-mCherry
UseIn vitro transcription (mrna synthesis)TagsmCherryPromoterUnknownAvailable SinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSP64-Lifeact-GFP
Plasmid#135601PurposeExpression of Lifeact-GFP mRNA for microinjection for visualization of actin in S. purpuratusDepositorInsertLifeact-GFP
UseIn vitro transcription (mrna synthesis)TagsEGFPPromoterUnknownAvailable SinceJan. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAWp63-clone32 (Opti-SpCas9)
Plasmid#131736PurposeExpresses Opti-SpCas9 in mammalian cellsDepositorInsertOpti-SpCas9
UseLentiviralTagsFlagMutationR661A+K1003HPromoterEFSAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pG3H-U6EC1
Plasmid#134758PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA-U6, zCas9-EC1Available SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_SPIC_P2A_Hygro_Barcode
Plasmid#120484PurposeBarcoded lentiviral vector to express SPIC in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-28a(+)-HMGS
Plasmid#108945Purposeheterologous expression of HMGS of E. faecalis in E. coliDepositorInsertHMG-CoA synthase (HMGS)
TagsHis6-TagExpressionBacterialMutationA110GAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
LI LacZ
Plasmid#104528PurposeLI lacZ moduleDepositorInsertlacZ
UseCloning vectorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-28a(+)-MVK mazei
Plasmid#108947Purposeheterologous expression of MVK of M. mazei in E. coliDepositorInsertMevalonate kinase (MVK)
TagsHis6-TagExpressionBacterialAvailable SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBP-ORF
Plasmid#72949PurposeEntry vector for ORF's - PCR, gene synthesis or sub-clone using NdeI/BamHI. Alternatively use BsaI with CATA and TCGA fusion sites. Stop codon must be included upstream of chosen 3' restriction siteDepositorInsertLevel 0 - ORFs
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pISH-Neurod1
Plasmid#74396PurposeUse to synthesize riboprobes for in situ hybridization (ISH) probe for Neurod1. Not for gene expression.DepositorInsertneurogenic differentiation 1 (Neurod1 Mouse)
Available SinceApril 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
Reb_82 aka PAS623
Plasmid#71228PurposeReb_1 with RebB(S82P, D88G)DepositorInsertReb locus
TagsnoneExpressionBacterialMutationRebB(S82P, D88G), RebA (G53A)Available SinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBS SK mCherryROSAbsr
Plasmid#54321PurposeEncodes mCherry fused with out-of-frame blasticidin-S resistance gene with a linker containing a target for TALEN/CRISPR. Can use as a surrogate target to select cells expressing active TALEN/CRISPR.DepositorInsertmCherry and BlasticidinS-resistance
UseCRISPR, Mouse Targeting, and TALENExpressionMammalianPromoterCMVAvailable SinceJuly 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
Nano-lantern-peroxisome/pcDNA3
Plasmid#51974Purposemammalian expression of Nano-lantern, a luminescent protein for high-speed single-cell and whole body imaging, targeted to peroxisomesDepositorInsertNano-lantern
TagsSKLExpressionMammalianMutationS257G in Rluc8Available SinceMarch 18, 2014AvailabilityAcademic Institutions and Nonprofits only