We narrowed to 13,278 results for: sequence
-
Plasmid#234429PurposePlasmid for Streptomyces containing gene of modified dCas9-BD protein and sequence of sgRNA cloning templateDepositorInsertModified dCas9(D10A, H840A) with polyaspartate linking
ExpressionBacterialMutationLinked polyaspartate using glycine-serine linkerAvailable SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
BPK1520
Plasmid#65777PurposeHuman expression plasmid for SpCas9 sgRNA (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-Sp-sgRNADepositorInsertSpCas9 gRNA backbone, without spacer sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSEZ-1
Plasmid#51868PurposeExpression of cpYFP with a mitochondrial-targeting sequence (mt-cpYFP) in C. elegansDepositorInsertpsdhb-1::mtLS-cpYFP
ExpressionWormPromotersdhb-1Available SinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2
Plasmid#75112Purposelenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2, dCas9-VP64, and blast resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceMay 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
Mito-PyronicSF/pCMV-myc-mito
Plasmid#124813PurposeHighly resposive GFP-based pyruvate nanosensor to explore mitochondrial metabolism.DepositorInsertPyronicSF
TagsMitochondrial Sequence SignalExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
Pepper-fused sgRNA
Plasmid#217520PurposeExpresses Pepper-fused sgRNA in mammalian cells with U6 promoterDepositorInsertPepper-fused sgRNA for spCas9
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA(MS2) cloning backbone
Plasmid#61424PurposesgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2. Contains BbsI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCIBN(deltaNLS)-pmGFP
Plasmid#26867PurposeExpresses CIBN(1-170, -NLS)-eGFP-CaaX fusion for use in light-inducible protein interaction modules for targeting to the plasma membraneDepositorInsertCIBN(deltaNLS)-pmGFP (CIB1 Mustard Weed)
TagsEGFPExpressionMammalianMutationNLS sequences mutatedPromoterCMVAvailable SinceFeb. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pQE81L-KOFP7
Plasmid#160330PurposeThis plasmid encodes an engineered oxygen-independent flavin binding fluorescent protein with N-terminal 6xHis tag. Its quantum yield is comparable to EGFP.DepositorInsertKOFP7
Tags6xHis tagExpressionBacterialPromoterT5Available SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
LifeAct-GFP-cytoB5RR
Plasmid#182577PurposeExpresses LifeAct-GFP targeted to the ER via the CytB5RR tail anchor sequenceDepositorInsertLifeAct-GFP-cytoB5RR
TagsLifeAct and cytoB5RRExpressionMammalianAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pTEF_Cas9
Plasmid#104909PurposehCas9 under control of Tef1 for direct cloning of HH-sgRNA-HDV PCR products and episomal expression in P. pastoris and G418 selectionDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTSin EGFP
Plasmid#127695PurposePlasmid contains the entire replication competent Sindbis genome with the structural genome components replaced by EGFP in an MCS locus. See Resource Information section for annotated plasmid sequenceDepositorInsertEGFP
UseSynthetic BiologyAvailable SinceJuly 3, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
ER-B
Plasmid#209870PurposeDimerization dependent fluorescent protein B anchored to cytosolic face of the endoplasmic reticulum membrane with N-terminal targeting sequence of rabbit CYP2C1DepositorInsertddGFP B
TagsTargeting domain of CYP2C1 MDPVVVLGLCLSCLLLLSLWKQ…ExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
ER-GA
Plasmid#209871PurposeDimerization dependent fluorescent protein GA anchored to cytosolic face of the endoplasmic reticulum membrane with N-terminal targeting sequence of rabbit CYP2C1DepositorInsertddGFP A
TagsTargeting domain of CYP2C1 MDPVVVLGLCLSCLLLLSLWKQ…ExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FlipCherry-T2A-GFP
Plasmid#124436PurposeExpresses FlipCherry (TEV cleavage sequence) and T2A GFP in mammalian cellsDepositorInsertFlipCherry-T2A-GFP
ExpressionMammalianAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
ER-RA
Plasmid#209872PurposeDimerization dependent fluorescent protein RA anchored to cytosolic face of the endoplasmic reticulum membrane with N-terminal targeting sequence of rabbit CYP2C1DepositorInsertddRFP A
TagsTargeting domain of CYP2C1 MDPVVVLGLCLSCLLLLSLWKQ…ExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEC3115 (pSpy0K6-P23_mKate2~*ssrA)
Plasmid#218509Purposeintegrative plasmid enabling constitutive expression of mKate2 in Streptococcus pyogenes, integrates into the transcriptionally silent locus Spy_1078 via homologous recombinationDepositorInsertmKate2
TagsssrA degradation tagExpressionBacterialMutationDeletion of Plac_mrfp cassette, introduction of a…PromoterP23Available SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
Mito-GA
Plasmid#209865PurposeDimerization dependent fluorescent protein GA anchored to cytosolic face of the mitochondrial membrane with C-terminal targeting sequence of human MAVSDepositorInsertddGFP A
TagsTargeting domain of MAVS RPSPGALWLQVAVTGVLVVTLLVV…ExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-msfGFP
Plasmid#194913PurposeTetracycline inducible expression of msfGFP in StaphylococciDepositorInsertShine Dalgarno Sequence followed by monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…ExpressionBacterialAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only