We narrowed to 864 results for: KO
-
Plasmid#227319PurposeDonor template for 2A-Puro insertion into the N-terminus of the TP53 locus. For selectable p53 knock-out. To be co-transfected with sgRNA plasmid px330-TP53 (Addgene #227318)DepositorInsertTP53 Homology Arms flanking a 2A-Puro Cassette (TP53 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA TR KO 2
Plasmid#207610PurposesgRNA 2 to knockout TR by replacement with a PuroR cassetteDepositorInsertTCAGGCCGCAGGAAGAGGAA
TagsNoneExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-hVASA-KO-WPRE
Plasmid#214124PurposeGene expression by Piggybac transposase in mammalian cellsDepositorInserthKO
ExpressionMammalianMutationCodon-optimized for mammalian cellsAvailable SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA TR KO 1
Plasmid#207609PurposesgRNA 1 to knockout TR by replacement with a PuroR cassetteDepositorInsertACCCTAACTGAGAAGGGCGT
TagsNoneExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-iRFP670-P2A-puro
Plasmid#208399Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, iRFP670 fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-Crimson-P2A-puro
Plasmid#208398Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, E2-Crimson fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsE2-CrimsonExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-mNeonGreen-P2A-puro
Plasmid#208400Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, mNeonGreen fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsmNeonGreenExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS02060_pMQ30_KO_Kan
Plasmid#185391PurposeNon-replicating vector used to create markerless deletion of RR42_RS02060 in C. basilensis 4G11DepositorInsertsRR42_RS02060 upstream flanking homology region
RR42_RS02060 downstream flanking homology region
Available SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS28935_pMQ30_KO_Kan
Plasmid#185392PurposeNon-replicating vector used to create markerless deletion of RR42_RS28935 in C. basilensis 4G11DepositorInsertsRR42_RS28935 upstream flanking homology region
RR42_RS28935 downstream flanking homology region
Available SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS18965_pMQ30_KO_Kan
Plasmid#185394PurposeNon-replicating vector used to create markerless deletion of RR42_RS18965 in C. basilensis 4G11DepositorInsertsRR42_RS18965 upstream flanking homology region
RR42_RS18965 downstream flanking homology region
Available SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS18970_pMQ30_KO_Kan
Plasmid#185395PurposeNon-replicating vector used to create markerless deletion of RR42_RS18970 in C. basilensis 4G11DepositorInsertsRR42_RS18970 upstream flanking homology region
RR42_RS18970 downstream flanking homology region
Available SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS17060_pMQ30_KO_Kan
Plasmid#185396PurposeNon-replicating vector used to create markerless deletion of RR42_RS17060 in C. basilensis 4G11DepositorInsertsRR42_RS17060 upstream flanking homology region
RR42_RS17060 downstream flanking homology region
Available SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS17055_pMQ30_KO_Kan
Plasmid#185398PurposeNon-replicating vector used to create markerless deletion of RR42_RS17055 in C. basilensis 4G11DepositorInsertsRR42_RS17055 upstream flanking homology region
RR42_RS17055 downstream flanking homology region
Available SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_eSOX17.2_KO
Plasmid#195495PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the core endoderm distal enhancer of human SOX17DepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-POLB-KO-g1
Plasmid#176090PurposeCas9 plus POLB gRNA #1; contains a puromycin resistance cassetteDepositorAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBluescript-Q22YU3-KO
Plasmid#170313PurposePlasmid for generating Tetrahymena thermophila somatic knockout strains for Q22YU3 with Paromomycin selectionDepositorInsertQ22YU3 knockout
UseTetrahymena somatic gene knockout vectorAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBluescript-Q22MS1-KO
Plasmid#170312PurposePlasmid for generating Tetrahymena thermophila somatic knockout strains for Q22MS1 with Paromomycin selectionDepositorInsertQ22MS1 knockout
UseTetrahymena somatic gene knockout vectorAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only