We narrowed to 9,067 results for: sgRNA
-
Plasmid#160674PurposeMobile CRISPRi sfGFP 'test', gmc6 sgRNADepositorInsertgmc6 (gfp) sgRNA
ExpressionBacterialAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWT062e
Plasmid#107910PurposeW2m.2-3 plasmid. Contains U6-LacI-sgRNA A and is ppart of the CAMERA2m system for cellular recording in mammalian cellsDepositorInsertU6-LacI-sgRNA A
ExpressionMammalianAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAL-pyk_T
Plasmid#74070PurposepAL374 plasmid carrying the pyk (T) sgRNA targeting the template strand of pyk, SpecRDepositorPublicationInsertsgRNA pyk (T)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterptacAvailable sinceApril 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAL-pck_T
Plasmid#74068PurposepAL374 plasmid carrying the pck (T) sgRNA targeting, the template strand of pck, SpecRDepositorPublicationInsertsgRNA pck (T)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterptacAvailable sinceApril 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFH6
Plasmid#86555PurposeSubcloning of any sgRNA via BbsI sites. Note that there is an improved version of this plasmid (Addgene 105866) that results in up to 10x greater efficiencyDepositorInsertU6-26p::sgRNA scaffold
UseCRISPR; SubcloningPromoterArabidopsis U6-26 promoterAvailable sinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSK-mU6-Cj-sgRNA-SV40-puro
Plasmid#192128PurposeExpresses Cj-SgRNA scaffold cloned with BbsI and puromycin resistance geneDepositorInsertCj-SgRNA scaffold
ExpressionMammalianAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMD19-Cas9_handle-S.pyogenes_terminator-PBBa_J23117-Cmr
Plasmid#190794PurposeTemplate vector to amplify pieces for creating multiplex sgRNA-arrays.DepositorInsertsgRNA-scaffold only
UseSynthetic BiologyExpressionBacterialPromoterBBa_J23117Available sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[3xPP7_SL]
Plasmid#68424PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. U6 promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertINT construct bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPB_mU6_enh-gRNA_Puro-T2A-BFP
Plasmid#235571PurposeEnhanced guide RNA expression & genomic integration. Target gRNA sequences are cloned in via the BstXI and BlpI sites.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA backbone
UseCRISPRAvailable sinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_pos9_AmpR
Plasmid#119152PurposeEncodes sgRNA targeting position 9 in pColE1_70a_deGFP_KanRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting position 9 in pColE1_70a_deGFP_KanR
UseCrisprAvailable sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAT005
Plasmid#171632Purpose2nd generation lentiviral transfer plasmid encoding a U6 promoter expressing a spyCas9 sgRNA targeting B2M and an EF1-a promoter expressing mNeonGreenDepositorInsertsspyCas9 sgRNA-B2M
mNeon
UseCRISPR and LentiviralExpressionMammalianPromoterEF1-a and U6Available sinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.Control
Plasmid#128749PurposeExpresses control gRNADepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available sinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Lenti-SLC35B2-sgRNA
Plasmid#154860PurposeLentiviral expression of Cas9 and sgRNA targeting SLC35B2DepositorAvailable sinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pB[U6-3 wex2 PUb-DsRed]
Plasmid#169010PurposeFor germline transformation. Expresses white exon 2 sgRNA and DsRed marker in all cells.DepositorInsertwhite ex2 sgRNA
UsePiggybacExpressionInsectPromoterDrosophila melanogaster U6:3Available sinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available sinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgPYM1
Plasmid#105249Purposehuman PYM1 sgRNADepositorInsertsgRNA for PYM1
ExpressionMammalianAvailable sinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTK73.ChrII_ttTi5605.sgRNA
Plasmid#194058PurposesgRNA targeting ChrII_ttTi5605 locus of the C. elegans genomeDepositorInsertChrII_ttTi5605 sgRNA
ExpressionWormPromoterU6Available sinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-SpCas9-miniU6-sgRNAShank3
Plasmid#213973PurposeAAV vector to express SpCas9 driven by pCALM1 promoter for targeting Shank3 locusDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.PAC
Plasmid#57829PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-PAC
UseCRISPR and LentiviralTagsFLAGAvailable sinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
sgOpti
Plasmid#85681PurposeLentiviral vector to express sgRNAs. The cloning site is BsmBI.DepositorPublicationTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by