We narrowed to 8,732 results for: sgRNA
-
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
3xMS2 TR knockin sgRNA 1
Plasmid#207607PurposesgRNA for homology directed repair insertion of 3xMS2-TR-100-PURO into the endogenous TR locusDepositorInsertcgactcgcccggcagcgcac
TagsNoneExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
3xMS2 TR knockin sgRNA 2
Plasmid#207608PurposesgRNA 2 for homology directed repair insertion of 3xMS2-TR-100-PURO into the endogenous TR locusDepositorInsertacccccaaacctgactgact
TagsNoneExpressionMammalianPromoterCMV and U6Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_NoFlag_ATP1A1_G3_SLBP_G1_Dual_sgRNA
Plasmid#191528PurposeVector for tandem expression of SLBP 3'UTR G1 sgRNA in combination with ATP1A1 G3 sgRNA from two independent U6 promoters to facilitate SLBP endogenous tagging by marker free coselection using ouabainDepositorInsertSLBP 3'UTR G1 sgRNA + ATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCriprV2-sgRNA-CRY2-#1
Plasmid#189989PurposeLentiviral Cas9/sgRNA vector targeting C-terminus of hCRY2, works with Addgene 189983-189986DepositorInsertCryptochrome-2 (CRY2 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCriprV2-sgRNA-PER1-#2
Plasmid#189988PurposeLentiviral Cas9/sgRNA vector targeting C-terminus of hPER1, works with Addgene 189979-189982DepositorInsertPeriod1 (PER1 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1 _8xCTS-ECFP-pA
Plasmid#200243PurposeMammalian transfections; 8xCTS-ECFP reporter construct 1DepositorInsertsgRNA1_8xCTS
ExpressionMammalianAvailable SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1 _1xCTS-ECFP-pA
Plasmid#200237PurposeMammalian transfections; 1xCTS-ECFP reporter construct 1DepositorInsertsgRNA1_1xCTS
ExpressionMammalianAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA5 _1xCTS-ECFP-pA
Plasmid#200241PurposeMammalian transfections; 1xCTS-ECFP reporter construct 5DepositorInsertsgRNA5_1xCTS
ExpressionMammalianAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA3 _1xCTS-ECFP-pA
Plasmid#200239PurposeMammalian transfections; 1xCTS-ECFP reporter construct 3DepositorInsertsgRNA3_1xCTS
ExpressionMammalianAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA4 _1xCTS-ECFP-pA
Plasmid#200240PurposeMammalian transfections; 1xCTS-ECFP reporter construct 4DepositorInsertsgRNA4_1xCTS
ExpressionMammalianAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA2 _1xCTS-ECFP-pA
Plasmid#200238PurposeMammalian transfections; 1xCTS-ECFP reporter construct 2DepositorInsertsgRNA2_1xCTS
ExpressionMammalianAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target2 (Mpphot)
Plasmid#186727PurposeGateway entry vector for sgRNA (target 2: Mpphot [negative control]). Transient expression of sgRNA (target 2: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
ExpressionBacterialAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only