We narrowed to 9,835 results for: CAG
-
Plasmid#241943PurposeExpresses an sgRNA targetting human GNAQDepositorAvailable sinceJuly 15, 2026AvailabilityAcademic Institutions and Nonprofits only
-
CTp132-Reporter-T
Plasmid#256441PurposeMammalian expression of a TSM with half of GFP-2A-BFP with best targeting spacerDepositorInsertTrans-splicing module with half of GFP-2A-BFP with best targeting spacer
ExpressionMammalianPromoterSFFVAvailable sinceJuly 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shFKBP8#2380
Plasmid#253963PurposeLentiviral shRNA-mediated knockdown of mouse FKBP8DepositorAvailable sinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX459-TMEM217-gRNA#1
Plasmid#249417PurposepX459-gRNA#1 targeting the 5′ coding region of human TMEM217DepositorInsertTMEM217 (TMEM217 Human)
UseCRISPRAvailable sinceFeb. 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX459-TMEM217-gRNA#2
Plasmid#249418PurposepX459 plasmid containing gRNA#2 targeting the end of the coding exon of human TMEM217DepositorInsertTMEM217 (TMEM217 Human)
UseCRISPRAvailable sinceFeb. 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133B-TLS-CsALSgR1.2
Plasmid#245878PurposeGolden gate entry vector carrying the 2nd gRNA for base editing in Carrizo citrange ALS gene along with TLS mobile RNA sequenceDepositorInsertCsALSgR1.2
UseCRISPR; Golden gate entry vectorExpressionPlantPromoterAtU3Available sinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133B-CsALSgR1.2
Plasmid#245876PurposeGolden gate entry vector carrying the 2nd gRNA for base editing in Carrizo citrange ALS geneDepositorInsertCsALSgR1.2
UseCRISPR; Golden gate entry vectorExpressionPlantPromoterAtU3Available sinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
DJ-L1 gRNA #4
Plasmid#247544PurposeCRISPRi-KD of human DJ LINE1DepositorInsertsgRNA targeting human L1DJ
UseCRISPRExpressionMammalianMutationnoneAvailable sinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Fzd1/2 gRNA
Plasmid#246562PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd1/2 gRNA (conserved region)DepositorInsertFzd1/2 gRNA
UseCRISPRPromoterU6Available sinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ39-PB-CRISPR-NKX3.1-E2-gRNA2
Plasmid#131082PurposeNKX3-1 knock outDepositorAvailable sinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW306_U6-sgRNA-EMX1
Plasmid#244824PurposeMammalian expression of SpyCas9 single guide RNA targeting EMX1DepositorInsertSpyCas9 single guide RNA
UseCRISPRExpressionMammalianPromoterU6Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMEF2c-AHF-DreERT2 (JDW 196)
Plasmid#242586PurposeThe Mef2c anterior heart field promoter driving expression of a tamoxifen inducible Dre recombinase.DepositorInsertDreERT2
ExpressionMammalianPromotermouse Mef2cAvailable sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP24 (pAVA3563)
Plasmid#239258PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP24DepositorInsertU6-driven sgRNA targeting RMP24
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOB-3xFlag-hGpr75-p.Ala110fs
Plasmid#236747PurposeExpress 3xFlag N-terminal tagged human GPR75 p.Ala110fs mutant transiently via transfection or stably via lentivirus-mediated infection in mammalian cells.DepositorInsertGPR75 (GPR75 Human)
UseLentiviralTags3xFlagExpressionMammalianMutationAla110fs, deletion of GCCAGTAAvailable sinceJuly 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbSTM-5'UTR
Plasmid#231150PurposeT-DNA encoding TRV2 with mobile gRNA targeting NbSTM-5?UTRDepositorInsertmobile gRNA targeting NbSTM-5?UTR
ExpressionPlantPromoterPEBV sub-genomicAvailable sinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 shCavin1KDR-EGFP
Plasmid#187254PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of mouse Cavin1 (Cavin1 rescue)DepositorAvailable sinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCG-NT2
Plasmid#229848PurposeExpresses wild-type Cas9 and gRNA with non-target sequence.DepositorInsertguide RNA with non-target sequence
UseCRISPRExpressionMammalianAvailable sinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-hL1-gRNA2-EGFP
Plasmid#226003PurposeCRISPRi-KD of human LINE1DepositorInsertsgRNA targeting human L1HS
ExpressionMammalianAvailable sinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only