We narrowed to 16,006 results for: grna
-
Plasmid#239588Purposeexpresses guide#1 to boost the expression of mouse Plxnb2, via CRISPRaDepositorInsertsgRNA targeting TSS-upstream reagion of Plxnb2 (Plxnb2 Mouse)
UseSleeping beauty (sb) transposonExpressionMammalianPromoterhU6Available sinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-MM002-ZFP143-C-terminal-sgRNA
Plasmid#212706PurposePlasmid for transient expression of pspCas9(BB)-2A-Puro nuclease and sgRNA targetting the C terminal of Zfp143 locusDepositorInsertZFP143 C-terminal sgRNA (Zfp143 Mouse)
UseCRISPRAvailable sinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-U6-(sgRNA-T2)-Chimeric_BB-CBh-hSpCas9
Plasmid#223323PurposeHuman codon optimized Cas9 expressing plasmid that carries the sgRNA T2 from Mali et al., 2013 (10.1126/science.1232033).DepositorInsertSpCas9 and sgRNA-T2 (cas9 )
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available sinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pC368: pAAV.CMV-Cas13e-VEGFA sgRNA2
Plasmid#227800PurposePlasmid expressing active Cas13e with VEGFA mRNA targeting gRNA2DepositorAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC369: pAAV.CMV-Cas13e-VEGFA sgRNA3
Plasmid#227801PurposePlasmid expressing active Cas13e with VEGFA mRNA targeting gRNA3DepositorAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tnnt2-Cre-U6-Lmna-sgRNA
Plasmid#206178PurposeExpresses Cre recombinase specifically in cardiomyocytes and uses U6 promoter to express sgRNAs targeting murine Lmna exon 10DepositorInsertCre
UseAAVPromotercTnTAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-L227R-ngRNA+15_EF1a-puroR
Plasmid#207360PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of L227R-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertL227R-CFTR +15 ngRNA
UseLentiviralAvailable sinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-recipient_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211651PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertGuide RNA recipient vector
UseCRISPR and LentiviralExpressionMammalianAvailable sinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF820-recipient_U6-sgRNA-EF1a-mCherry2
Plasmid#211647PurposeU6-sgRNA-EF1a-mCherry2DepositorInsertGuide RNA recipient vector
UseCRISPR and LentiviralExpressionMammalianAvailable sinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmATM
Plasmid#208392PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ATM gene.DepositorAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmMRE11
Plasmid#208384PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine MRE11 gene.DepositorAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#3
Plasmid#208389PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#3 gene.DepositorAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmMLKL
Plasmid#208391PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine MLKL gene.DepositorAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 hU6 HEK3 PegRNA
Plasmid#206277PurposeENTR Vector 2 for MultiSite Gateway assembly. Encodes HEK3 PegRNADepositorInsertHEK3 PegRNA
UseCRISPR; Multimate/gateway entr 2ExpressionMammalianAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available sinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-tdTomato-sgRNA
Plasmid#194724Purposebased on (CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector, Addgene 159281), with guide RNA that target tdTomatoDepositorInsertAsCpf1
UseCRISPRExpressionMammalianAvailable sinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-3 lentiCRISPR v2-Blast plasmid
Plasmid#192233Purposelentiviral vector expressing sgRNA-3 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-3 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-5 lentiCRISPR v2-Blast plasmid
Plasmid#192230Purposelentiviral vector expressing sgRNA-5 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-5 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192234Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192229Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only