We narrowed to 13,211 results for: CAR
-
Plasmid#178263PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.NWS.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNAscaffold 2.1 scRNA (GB1437)
Plasmid#160571PurposeVersion of SgRNA scaffold with the sequence 2.1 of Ms2 aptamer in the 3' end.DepositorInsertsgRNAscaffold 2.1 scRNA
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
iDuet101a-mCHF1
Plasmid#55611PurposeLentivirus containing mouse Hey2 coding regionDepositorAvailable SinceJuly 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pLKO_NWS.HA.V5_mCherry-NLS
Plasmid#178283PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNWS.HA.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
Flag Depdc5 pLJM1
Plasmid#46336DepositorInsertDepdc5 (DEPDC5 Human)
UseLentiviralTagsFlagExpressionMammalianMutationDiffers from Depdc5 isoform 1 by 10 amino acids …Available SinceJuly 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
Frt-hspB8
Plasmid#63099PurposeExpression of HSPB8 (small HSP) in mammalian cellsDepositorAvailable SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.VSVg.V5_mCherry-NLS
Plasmid#178236PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.VSVg.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.S.VSVg_mCherry-NLS
Plasmid#178234PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.S.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSAM2_mCherry_Nkx2.5
Plasmid#72689PurposeDoxycyline regulated expression of Nkx2.5 in mammalian cellsDepositorAvailable SinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.V5_mCherry-NLS
Plasmid#178242PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(A)
Plasmid#85570PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:MS2:EDLL:Tnos (GB1738)
Plasmid#160622PurposeTU for the constitutive expression of the MS2 coat protein fused on Ct to the activation domain EDLLDepositorInsertP35s_MS2:EDLL_Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Control-cx43.4-48H-pPRISM
Plasmid#117801PurposeControl to test technique on a target that is known to workDepositorInsertTagRFP
UseSynthetic BiologyAvailable SinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRCreb5gRNA
Plasmid#195021PurposeSequence specific sgRNA that guide Cas9 to the genomic region encoding the bovine Creb5 DNA binding domainDepositorAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCX4-Oct4
Plasmid#36116DepositorAvailable SinceApril 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLX307 DEDD
Plasmid#117744PurposeOpen reading frame vector encoding DEDDDepositorAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
EPHA3_1-972 pcDNA3.1
Plasmid#102739PurposeExpression of EPHA3 in mammalian cellsDepositorAvailable SinceFeb. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
TMED3-hLOV-TEVcs-GAL4bd-VP64-V5
Plasmid#170996PurposeHiLITR transcription factor with full-length TMED3 targeting sequence (ER/Golgi)DepositorInsertTMED3(FL)-NNES-hLOV-TEVcs(ENLYFQ/M)-GAL4bd-VP64-V5 (TMED3 Synthetic)
UseLentiviral and Synthetic BiologyTagsV5ExpressionMammalianPromoterEf1-alphaAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only