We narrowed to 10,121 results for: EPO
-
Plasmid#103413PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-30c-1-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-30c-1-3p target (MIR30C1 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
Luc-Hdm4-3'UTR-F2d5
Plasmid#64018PurposeLuciferase reporter of human Hdm4 3'UTR F2 fragment mutant #5DepositorInsertHDMX (MDM4 Human)
ExpressionMammalianAvailable SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-25-5p
Plasmid#103376PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-25-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7e-5p
Plasmid#103153PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7e-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7e-5p target (MIRLET7E Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7e-3p
Plasmid#103152PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7e-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7e-3p target (MIRLET7E Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_mP_CMV
Plasmid#99313PurposeLuciferase validation vector with CMV enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertCMV enhancer
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIS1-mutant RhoA 3'UTR
Plasmid#26090DepositorInsertmutant RhoA 3'UTR (RHOA Human)
UseLuciferaseExpressionMammalianMutationBoth miR-31 binding sites in 3’ UTR mutagenized. …Available SinceOct. 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
CIP2Aprom285bp-pGL4.10Luc
Plasmid#60873PurposeLuc reporter driven by 285 bp of the CIP2A promoterDepositorInsert285 bp promoter fragment of Cancerous Inhibitor of PP2A2 (CIP2A Human)
UseLuciferase; PromoterlessAvailable SinceApril 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEMS1210
Plasmid#29107PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
LentiX_(loxPconDIAL-YB_TATA)-mCherry-HRasG12V-BGH_pKG3906
Plasmid#246345PurposeloxPcon DIAL Reporter Lentivirus expressing mCherry-HRasG12V in the presence of ZFaDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HSPA1A-CytoTape-V5
Plasmid#239426PurposeCytoTape signal monomer for recording HSPA1A promoter transcriptional activityDepositorInsertCytoTape-V5 (HSPA1A Synthetic)
UseAAVTagsV5-dMBPExpressionMammalianPromoterHSPA1A promoterAvailable SinceOct. 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVKS-1
Plasmid#233086PurposeHNRNPD full-length promoter reporter constructDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(WT)-mascRNA](pAVA2965)
Plasmid#239351PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
ExpressionMammalianAvailable SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-zFUCCI (JDW 1464)
Plasmid#242558PurposeGateway middle entry clone containing zebrafish FUCCI reporter; For visualizing cell cycle state.DepositorInsertmCerulean-zGeminin(1-100) P2A mCherry-zCdt1(1-190)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mStayGold-WPRE (JDW 1384)
Plasmid#242550PurposeGateway middle entry clone containing H2B-mStayGold with WPRE at the 3' end; Nuclear green fluorescent reporterDepositorInsertmStayGold (monomeric StayGold)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mBaoJin-WPRE (JDW 1383)
Plasmid#242549PurposeGateway middle entry clone containing H2B-mBaoJin with WPRE at the 3' end; Nuclear green fluorescent reporterDepositorInsertmBaoJin
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-mCerulean3-TUBB1A (JDW 1508)
Plasmid#242555PurposeGateway middle entry clone containing mCerulean3-TUBB1A; Cyan fluorescent reporter for visualizing tubulin in cellsDepositorInsertmCerulean3-TUBB1A
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror RFP[ENE(WT)-mascRNA](pAVA2987)
Plasmid#239348PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
ExpressionMammalianAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS2784 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-20a CMV-BFP
Plasmid#240514PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-20 Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only