We narrowed to 19,068 results for: cat
-
Plasmid#246555PurposeCRISPR vector co-expressing Cas9 and a mouse Dvl1/3 gRNA (conserved region)DepositorInsertDvl1/3 gRNA
UseCRISPRPromoterU6Available SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgSnrk
Plasmid#177236PurposeExpresses neomycin (bU6), non-targeting (mU6) and Snrk (hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgSnrk
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNuak1-hU6-sgNuak2
Plasmid#177234PurposeExpresses Neomycin (bU6), Nuak1 (mU6) and Nuak2(hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNuak1/sgNuak2
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgAmpk1-hU6-sgAmpk2
Plasmid#177233PurposeExpresses Neomycin (bU6), Ampk1 (mU6) and Ampk2(hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgPrkaa1/sgPrkaa2
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
CtkA_D155Q/D179Q_cmv-10
Plasmid#27435DepositorInsertCell translocating kinas A (jhp0940 H. pylori)
Tags3xFLAGExpressionMammalianMutationD155Q/D179QAvailable SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLP-TK (pCTC174)
Plasmid#254034PurposemSwAP-In/Big-IN Landing Pad plasmid encoding pEF1a-driven PuroR-dTK-P2A-HaloTag expression cassette flanked by LoxM/LoxP sites and BsaI homology arms cloning sites. FCU1-counterselectable backbone.DepositorInsertPuroR-dTK-P2A-HaloTag
UseSynthetic Biology; Mouse targeting, recombinase-m…ExpressionMammalianPromoterhuman EF1aAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/MALAT1[WT] (pAVA3171)
Plasmid#239347PurposeExpresses full-length, driven by its own promoter MALAT1 with wild-type ENE and an 11-nt insertion (cgctcgacgta).DepositorInsert10,843 bp of MALAT1 of genomic locus amplified from genomic DNA of Hela cells (MALAT1 Human)
ExpressionMammalianMutationAn 11-nt insertion (cgctcgacgta)Available SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-flex-iGluSnFR4s-PDGFR-WPRE
Plasmid#234439PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAV and Cre/LoxTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAX-SCLM
Plasmid#216757PurposeFor strong and long-lasting expression of SuperClomeleon in mammalian cells from the hybrid CAG promoterDepositorInsertSuperClomeleon
ExpressionMammalianMutationS30R and 11 AA deletion in the Cerulean CFP moiet…PromoterCAG (cytomegalovirus-chicken beta-actin-rabbit be…Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJS288
Plasmid#200714PurposeTo express yeast Hxt1 hexose transporter in yeastDepositorUseSynthetic BiologyTagsmCherryExpressionYeastMutationdomesticated for MoClo cloning (removal of intern…Available SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pB80-hsKIF5B(1-560)Rigor-L-mVenus
Plasmid#193720PurposeExpression of mVenus tagged human kinesin-1 (KIF5B aa1-560) to anchor microtubulesDepositorInserthsKIF5B(1-560)Rigor-L-mVenus (KIF5B Human, Synthetic)
TagsmVenusExpressionMammalianMutationhsKIF5B(aa1-560), RIGOR: G234A; mVenus: Met1Del, …PromoterChicken beta-actinAvailable SinceMarch 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCM167.2-Venus-VF-hADAM10(aa1-213)
Plasmid#189554PurposeProtein expression ADAM10 in mammalian cells. Contains only prodomain--amino acids 1-213DepositorInserttruncated ADAM metallopeptidase domain 10 (ADAM10 Human)
TagsVFExpressionMammalianMutationcontains aa 1-213Available SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCM167-Venus-VF-hADAM10(aa220-654)
Plasmid#189560PurposeProtein expression ADAM10 in mammalian cells. Contains metalloprotease, disintegrin, and cysteine rich domains--amino acids 220-654DepositorInserttruncated ADAM metallopeptidase domain 10 (ADAM10 Human)
TagsVFExpressionMammalianMutationcontains aa 220-654Available SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
FUW-crRNA-scrambled-U6_TRE-dLbCpf1-NLS-hCTCF_WT-HA-P2A-tagBFP
Plasmid#194897PurposeDox-inducible all-in-one lentiviral construct to express dCpf1-CTCF-WT and scrambled crRNA without target in human genome.DepositorInsertsdLbCpf1-NLS-hCTCF_WT
U6-crRNA-scramble
UseLentiviralTagsHAExpressionMammalianMutationHuman codon optimized catalytically inactive LbCp…PromoterTRE and U6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-GpA
Plasmid#191238PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of GpA and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), GYPA (GPA) (E(transmembrane)R)
Tagsnuclease A from S. aureus fused to the TM domain …ExpressionBacterialMutationChanged Alanine 112 to CysteinePromoterT7 promoterAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCM167-Venus-VF-hADAM10(aa1-459)
Plasmid#189559PurposeProtein expression ADAM10 in mammalian cells. Contains prodomain and metalloprotease domain--amino acids 1-459DepositorInserttruncated ADAM metallopeptidase domain 10 (ADAM10 Human)
TagsVFExpressionMammalianMutationcontains aa 1-459Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
p1.1-eGFP
Plasmid#162738PurposeFluorescent reporter for CHO cells expression studiesDepositorInsertenhanced green fluorescent protein
ExpressionMammalianMutationconsensus Kozak sequence (GCCGCCATGG) added befor…PromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTA231-p.Syn-Dendra2Hfx
Plasmid#164660Purposeexpression of H. volcanii codon-optimized Dendra2DepositorInsertDendra2Hfx
UseArchaeal expressionMutationcodon-optimization for Haloferax volcaniiPromoterp.SynAvailable SinceFeb. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-HIS-ELP-ddFLN4-I27-XMod-Doc (wild type)
Plasmid#153442PurposeE. coli expression of Rc. XDocB wild-type construct containing ybbr tag, ELP linker and ddFLN4 and I27 fingerprint domains. This construct was designed for AFM measurements.DepositorInsertRc.XDocB
Tags3xELP linker, 6xHis, Titin I27, ddFLN4 fingerprin…ExpressionBacterialPromoterT7 promoterAvailable SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only