We narrowed to 4,936 results for: AAT
-
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-1
Plasmid#177781PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-2
Plasmid#177782PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-14kb-USF-1-6
Plasmid#227470Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-14kb-USF-7-12
Plasmid#227471Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-700bp-USF
Plasmid#227478Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 700bp Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-58kb-USF
Plasmid#227457Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 58kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-20kb-USP
Plasmid#227446Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 20kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-ILF2-ts2
Plasmid#174263PurposeILF2 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-DDX58-ts2
Plasmid#174242PurposeDDX58 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
TLNRD1(4H)-2T_pET47b
Plasmid#224069PurposeBacterial expression of the 4-helix bundle of TLNRD1 (residues 143-273) containing the mutations L191T/A225T, fused to an N-terminal hexa-histidine tag. HRV-3C cleavage siteDepositorInserttlnrd1 (TLNRD1 Human)
Tags6xHISExpressionBacterialMutationL191T/A225T double mutant; reduces affinity of TL…PromoterT7Available SinceAug. 26, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
TLNRD1(4H)-2E_pET151
Plasmid#224068PurposeBacterial expression of the 4-helix bundle of TLNRD1 (residues 143-273) containing the mutations K192E/R233E, fused to an N-terminal hexa-histidine tag. TEV cleavage siteDepositorInserttlnrd1 (TLNRD1 Human)
Tags6xHIS; V5ExpressionBacterialMutationK192E/R233E double mutant; prevents actin binding…PromoterT7Available SinceAug. 26, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
AA244
Plasmid#215945PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD59_v1 [Sp]; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-pcr4
Plasmid#193662PurposeExpression of tandem pre-sgRNA array pcr4 for LbCas12aDepositorInsertU6-PUM1-sgRNA-GHR-sgRNA-HMGA2-sgRNA-PUM2-sgRNA-tRNA
ExpressionMammalianPromoterU6Available SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCM2_I432D_eGFP
Plasmid#208879PurposeExpress eGFP-CCM2 with the I432D mutation in mammalian cells.DepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
CCM2_W421AD422A_eGFP
Plasmid#208880PurposeExpress eGFP-CCM2 with the W421A and D422A mutations in mammalian cells.DepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
CCM2_I428S_eGFP
Plasmid#208878PurposeExpress eGFP-CCM2 with the I428S mutation in mammalian cells.DepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-PGM2_sgRNA1
Plasmid#201616PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPGM2 (PGM2 Human)
UseCRISPR and LentiviralAvailable SinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only