We narrowed to 9,707 results for: crispr plasmids
-
Plasmid#199223PurposeDonor plasmid with CCR5 target sites for ITPN or HMEJ knock-in at the human CCR5 safe harbour locusDepositorInsertExpression unit for mCherry - monomeric derivative of DsRed fluorescent protein (Shaner et al., 2004)
UseGene targeting donor plasmidExpressionMammalianPromoterHuman PGK1 gene promoterAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9.luxR(mut)-sggfp
Plasmid#236185PurposeThe plasmid pQdCas9.luxR(mut)-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the GFP gene. Additionally, this plasmid contains a mutation in the luxR gene.DepositorInsertQuorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFB_ROSA26_SpCas9_gRNAs
Plasmid#174703PurposePlasmid containing separate SpCas9 gRNAs for targeted excision of inserted STOP Cassette upstream of reporter alleles found in Ai14 and Ai6 mice. ITRs flank the cassette for easy vector creation.DepositorInsertSpCas9 dual gRNAs
UseAAVAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCBh-NLS_hfCas13d(RfxCas13d_N2V8)_HA_NLS-pA-U6-DR-BpiI-BpiI-pSV40-EGFP-pA-pSV40-mCherry-pA
Plasmid#190034Purposevector for encoding a human codon-optimized High-fidelity RfxCas13d (hfCas13d) driven by CBh promoter, guide RNAs compatible with RfxCas13d driven by hU6, EGFP and mCherry driven by SV40 promotersDepositorInserthumanized hfCas13d
ExpressionMammalianMutationA134V,A140V,A141V,A143VPromoterCBh, SV40, hU6Available SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-spCas9
Plasmid#231404PurposeExpresses spCas9 from hSyn promoterDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgTP53_3
Plasmid#78164PurposesgTP53DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAi14-luc-MC
Plasmid#87113Purposeminicircle parental backbone plasmid including luc-pA knock-in donor and one cutting site for HITIDepositorInsertLuciferase-SV40pA
UseCRISPR and LuciferaseAvailable SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-GFP-Gal8
Plasmid#127191PurposePiggybac transposon plasmid with CAG promoter GFP-Galectin 8 (GFP-Gal8) fusion protein. Useful as genetically encoded endosomal escape sensor.DepositorInsertGFP-Gal8 (LGALS8 Human)
TagsGal8 is fused to the c-terminus of GFPExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-SpCas9-miniU6-sgRNAShank3
Plasmid#213973PurposeAAV vector to express SpCas9 driven by pCALM1 promoter for targeting Shank3 locusDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgCtrl_EF1a-Puro-T2A-BFP
Plasmid#195500PurposeLentiviral BFP expression vector bearing a sgRNA targeting a randomized human TSS sequenceDepositorInsertsgRNA
UseCRISPR and LentiviralTagsBFP, Puro, and T2AExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
AP1muA-TurboID-polyA-G418 HR
Plasmid#227734PurposeHomology repair plasmid for endogenous tagging of AP1muA at the C-terminus with TurboID and a V5 epitope tag. Contains a G418 resistance cassette for selection of edited cells.DepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L
Plasmid#224381PurposeLenti plasmid for generating GNB1L expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
ExpressionBacterial and MammalianAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
CLYBL-TO-hNGN2-BSD-mApple
Plasmid#124229PurposeTargets the human CLYBL safe harbor locus for integration of dox-inducible NGN2 for differentiation of iPSCs into cortical neurons. Contains a floxed BSD-NLS-mApple selection cassette.DepositorInsertNGN2 (NEUROG2 Human)
ExpressionMammalianAvailable SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBK2044-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223164Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER dCas9-TET1CDMut
Plasmid#101920PurposeThe dCas9-TET1CDMut fusion protein is cloned into the pINDUCER lentiviral backbone (Addgene plasmid# 46948). The TET1 catalytic domain is mutated to abolish catalytic function.DepositorInsertdCas9-TET1CD Mut
UseLentiviralExpressionMammalianMutationMutated TET1 catalytic domainAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPD0039_CROP-seq-CAR-Puro
Plasmid#242532PurposeCAR T screeningDepositorInsertCD19-BB CAR (CD19 Human)
UseLentiviralAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_051_dCas9-KRAB-HA
Plasmid#228936PurposeAll-in-one dCas9-KRAB-MeCP2 plasmid for cloning of custom sgRNADepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-CBE N-terminal
Plasmid#137175PurposeAAV genome: expresses the N-terminal of v5 AAV-CBE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-CBE N-terminal; U6-protospacer
UseAAVMutationCas9 D10APromoterCbhAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only