We narrowed to 16,006 results for: grna
-
Plasmid#84254PurposeExpresses optimized Sa sgCXCR4-1 gRNA with an EGFP fluorescent markerDepositorInsertSa sgCXCR4-1
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pSEVA63_sgRNA-B0_M13ps
Plasmid#231421PurposeM13 phagemid constitutively expressing sgRNA-B0. sgRNA-B0 is a dummy 20-nt sequence, containing a Golden Gate cloning site (BsaI). (A gift of the Jaramillo Lab, where it is called PAJ552.)DepositorInsertsgRNA-B0
UseSynthetic BiologyAvailable sinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA63_sgRNA-B1_M13ps
Plasmid#231422PurposeM13 phagemid that expresses sgRNA-B1 from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ615.)DepositorInsertsgRNA-B1
UseSynthetic BiologyAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
HaloXRCC4 sgRNA
Plasmid#207606PurposesgRNA for the insert of the HaloTag at the endogenous loci of XRCC4.DepositorInsertTACTGGGTTCAGAAACAAGG
ExpressionMammalianAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_sgRNA-C1_M13ps
Plasmid#231411PurposeM13 phagemid that expresses sgRNA-C1 (= sgRNA A5T from Nielsen et al., 2014) from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ272.)DepositorInsertsgRNA-C1
UseSynthetic BiologyAvailable sinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA26_sgRNA-2_M13ps
Plasmid#231412PurposeM13 phagemid that expresses sgRNA-2 from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ171.)DepositorInsertsgRNA-2
UseSynthetic BiologyAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA26_sgRNA-A0_M13ps
Plasmid#231413PurposeM13 phagemid constitutively expressing sgRNA-A0. sgRNA-A0 is a dummy 20-nt sequence, containing a Golden Gate cloning site (BsaI).DepositorInsertsgRNA-A0
UseSynthetic BiologyAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_LacI_pLac-sgRNA-1
Plasmid#231408PurposesgRNA-1 expression from an IPTG-inducible promoter.DepositorInsertssgRNA-1
LacI
UseSynthetic BiologyAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_AraC_pBAD-sgRNA-1
Plasmid#231407PurposesgRNA-1 expression from an arabinose-inducible promoter.DepositorInsertssgRNA-1
AraC
UseSynthetic BiologyAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA26_sgRNA-A1_M13ps
Plasmid#231414PurposeM13 phagemid that expresses sgRNA-A1 from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ164.)DepositorInsertsgRNA-A1
Available sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_sgRNA-C0_M13ps
Plasmid#231410PurposeM13 phagemid constitutively expressing sgRNA-C0. sgRNA-C0 is a dummy 20-nt sequence, containing a Golden Gate cloning site (BsaI). (A gift of the Jaramillo Lab, where it is called PAJ156.)DepositorInsertsgRNA-C0
UseSynthetic BiologyAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_sgRNA-1_M13ps
Plasmid#231409PurposeM13 phagemid that expresses sgRNA-1 from a strong constitutive promoter.DepositorInsertsgRNA-1
UseSynthetic BiologyAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
p103DestTol2pA2-4xU6sgRNA
Plasmid#227778PurposeDestination vector with U6 driven 4 sgRNAsDepositorInsert4xU6:sgRNA
UseCRISPRPromoterU6Available sinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG13 sgRNA
Plasmid#207558PurposepX330 expressing Cas9 and a sgRNA targeting the ATG13 locusDepositorInsertggaaactgatctcaattccc
ExpressionMammalianPromoterCMV and U6Available sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA5_8xCTS-ECFP-pA
Plasmid#200247PurposeMammalian transfections; 8xCTS-ECFP reporter construct 5DepositorPublicationInsertsgRNA5_8xCTS
ExpressionMammalianAvailable sinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA3_8xCTS-ECFP-pA
Plasmid#200245PurposeMammalian transfections; 8xCTS-ECFP reporter construct 3DepositorPublicationInsertsgRNA3_8xCTS
ExpressionMammalianAvailable sinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only