We narrowed to 88,932 results for: Mal;
-
Plasmid#242882PurposeMammalian expression of epegRNA for twin prime editing of half the minimal PhiC31 attP site targeting the human AAVS1 siteDepositorInsertepegRNA for PhiC31 attP site
ExpressionMammalianMutationnonePromoterU6Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6 pegRNA AAV 3b PhiC31 attP41
Plasmid#242883PurposeMammalian expression of epegRNA for twin prime editing of half the minimal PhiC31 attP site targeting the human AAVS1 siteDepositorInsertepegRNA for PhiC31 attP site
ExpressionMammalianMutationnonePromoterU6Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6 pegRNA ROSA 4b Bxb1 attB38
Plasmid#242879PurposeMammalian expression of epegRNA for twin prime editing of half the minimal Bxb1 attB site targeting the human ROSA26 siteDepositorInsertepegRNA for Bxb1 attB site
ExpressionMammalianMutationnonePromoterU6Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6 pegRNA ROSA 4a Bxb1 attB38
Plasmid#242878PurposeMammalian expression of epegRNA for twin prime editing of half the minimal Bxb1 attB site targeting the human ROSA26 siteDepositorInsertepegRNA for Bxb1 attB site
ExpressionMammalianMutationnonePromoterU6Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6 pegRNA ROSA 4a PhiC31 attP41
Plasmid#242880PurposeMammalian expression of epegRNA for twin prime editing of half the minimal PhiC31 attP site targeting the human ROSA26 siteDepositorInsertepegRNA for PhiC31 attP site
ExpressionMammalianMutationnonePromoterU6Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_Mut(D1399Y)_p300_core-dCas9-EGFP_hygro
Plasmid#226427PurposePiggyBac transposon vector containing a dox inducible mutant p300 core-dCas9 fusion protein (p300 core mutation: D1399Y) and EGFP reporter. Hygromycin selection marker.DepositorInsertsMutant p300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, Mutant p300 core, and P2A-EGFPExpressionMammalianMutationp300 core mutation (D1399Y)PromoterDox inducible minimal CMV and UbC PromoterAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-Ace-mNeon2-WPRE
Plasmid#240056PurposeCre dependent Green fluorescent, negative response-polarity voltage indicator for mammalian expressionDepositorInsertAce-mNeon2
UseAAVPromoterEf1aAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-Trim21-OLLAS
Plasmid#237438PurposeExpresses mouse Trim21 ubiquitin ligase tagged with OLLAS at C-term; made for in vitro transcription (T7 promoter)DepositorAvailable SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_EGFP-BRD4-NUT-KS-FtoG
Plasmid#238256PurposeFor overexpression of EGFP-BRD4-NUT-KS-FtoGDepositorInsertEGFP-BRD4-NUT-KS-FtoG
ExpressionMammalianAvailable SinceJune 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
mscv_EGFP-IRES-NUP98-KDM5A-KS
Plasmid#238290PurposeFor overexpression of EGFP-IRES-NUP98-KDM5A-KSDepositorInsertEGFP-IRES-NUP98-KDM5A-KS
ExpressionMammalianAvailable SinceJune 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-YAP-MAML2-KS
Plasmid#238276PurposeFor overexpression of mEGFP-YAP-MAML2-KSDepositorInsertmEGFP-YAP-MAML2-KS
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
mscv_EGFP-IRES-NUP98-KDM5A
Plasmid#238289PurposeFor overexpression of EGFP-IRES-NUP98-KDM5ADepositorInsertEGFP-IRES-NUP98-KDM5A
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_EGFP-BRD4-NUT-KS
Plasmid#238255PurposeFor overexpression of EGFP-BRD4-NUT-KSDepositorInsertEGFP-BRD4-NUT-KS
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_VHH05-EGFP-NPM1
Plasmid#238268PurposeFor overexpression of VHH05-EGFP-NPM1DepositorInsertVHH05-EGFP-NPM1
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
mscv_EGFP-NUP98-KDM5A-KS-FtoA
Plasmid#238295PurposeFor overexpression of EGFP-NUP98-KDM5A-KS-FtoADepositorInsertEGFP-NUP98-KDM5A-KS-FtoA
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only