We narrowed to 11,225 results for: Kars
-
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSECC
Plasmid#60820Purpose3rd generation vector. Expresses a sgRNA of interest, Cas9 and CreDepositorInsertsCas9
Cre
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingTagsFlagExpressionMammalianMutationBsmBI site eliminated by C->A; E308GPromoterEFS and EFS (after Cas9-2A)Available SinceNov. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
FAT FAK biosensor
Plasmid#78303PurposeFRET biosensor. Visualization of FAK activity at focal adhesions in live cellsDepositorInsertFAT FAK biosensor
ExpressionMammalianPromoterCMVAvailable SinceJune 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHEN-CoV2-nanobody-G6
Plasmid#194589PurposeBacterial expression of G6 nanobody targeting the receptor binding domain (RBD) of SARS-CoV-2 spikeDepositorInsertG6 (S )
ExpressionBacterialAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
PPP1CA
Plasmid#155843PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(ER).iGlucoSnFR2.H348H.HaloTag
Plasmid#244074PurposeER expression of green glucose sensor (high affinity) with non-responsive HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
UseAAVTagsCalreticulin and HaloTagAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(cyto).iGlucoSnFR2.H348H.HaloTag
Plasmid#244070PurposeCytosolic expression of green glucose sensor (high affinity) with non-responsive HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.TBG.(cyto).iGlucoSnFR2.mIRFP670nano3
Plasmid#244103PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBVboostFGII WPRE 2A-CVB3
Plasmid#202076PurposeBacterial expression of 2A protease from coxsackievirus B3 (CVB3). Contains C-terminal His6-tag.DepositorInsertCVB3 2A protease with HisTag
Tags6xHis-tagExpressionBacterial, Insect, and Mamm…Promoterpolh, CAG, T7Available SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
SFRS10
Plasmid#156007PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only