We narrowed to 15,910 results for: grna
-
Plasmid#231449PurposeEmpty backbone which expresses a unique 3 epitope tag on the histone H2bc3. This can be used for CRISPR knockdown of genes via ligation of gRNA oligos downstream of the U6 promoter. This plasmid is to be used with gRNAs.DepositorTypeEmpty backboneUseRetroviralTagsC, FLAG, and VSVgExpressionMammalianPromoterhU6Available sinceJuly 17, 2026AvailabilityAcademic Institutions and Nonprofits only
-
Flowcode_01
Plasmid#231423PurposeEmpty backbone which expresses a unique 3 epitope tag on the histone H2bc3. This can be used for CRISPR knockdown of genes via ligation of gRNA oligos downstream of the U6 promoter. This plasmid is to be used with gRNAsDepositorTypeEmpty backboneUseRetroviralTagsAU1, C, and FLAGExpressionMammalianPromoterhU6Available sinceJuly 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
Flowcode_02
Plasmid#231424PurposeEmpty backbone which expresses a unique 3 epitope tag on the histone H2bc3. This can be used for CRISPR knockdown of genes via ligation of gRNA oligos downstream of the U6 promoter. This plasmid is to be used with gRNAs.DepositorTypeEmpty backboneUseRetroviralTagsAU1, C, and HAExpressionMammalianPromoterhU6Available sinceJuly 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
Flowcode_03
Plasmid#231425PurposeEmpty backbone which expresses a unique 3 epitope tag on the histone H2bc3. This can be used for CRISPR knockdown of genes via ligation of gRNA oligos downstream of the U6 promoter. This plasmid is to be used with gRNAs.DepositorTypeEmpty backboneUseRetroviralTagsAU1, C, and OLLASExpressionMammalianPromoterhU6Available sinceJuly 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
Flowcode_04
Plasmid#231426PurposeEmpty backbone which expresses a unique 3 epitope tag on the histone H2bc3. This can be used for CRISPR knockdown of genes via ligation of gRNA oligos downstream of the U6 promoter. This plasmid is to be used with gRNAs.DepositorTypeEmpty backboneUseRetroviralTagsAU1, C, and SExpressionMammalianPromoterhU6Available sinceJuly 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
Flowcode_05
Plasmid#231427PurposeEmpty backbone which expresses a unique 3 epitope tag on the histone H2bc3. This can be used for CRISPR knockdown of genes via ligation of gRNA oligos downstream of the U6 promoter. This plasmid is to be used with gRNAs.DepositorTypeEmpty backboneUseRetroviralTagsAU1, C, and VSVgExpressionMammalianPromoterhU6Available sinceJuly 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
Flowcode_06
Plasmid#231430PurposeEmpty backbone which expresses a unique 3 epitope tag on the histone H2bc3. This can be used for CRISPR knockdown of genes via ligation of gRNA oligos downstream of the U6 promoter. This plasmid is to be used with gRNAs.DepositorTypeEmpty backboneUseRetroviralTagsAU1, C, and V5ExpressionMammalianPromoterhU6Available sinceJuly 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
Flowcode_07
Plasmid#231431PurposeEmpty backbone which expresses a unique 3 epitope tag on the histone H2bc3. This can be used for CRISPR knockdown of genes via ligation of gRNA oligos downstream of the U6 promoter. This plasmid is to be used with gRNAs.DepositorTypeEmpty backboneUseRetroviralTagsAU1, FLAG, and HAExpressionMammalianPromoterhU6Available sinceJuly 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
Flowcode_08
Plasmid#231432PurposeEmpty backbone which expresses a unique 3 epitope tag on the histone H2bc3. This can be used for CRISPR knockdown of genes via ligation of gRNA oligos downstream of the U6 promoter. This plasmid is to be used with gRNAs.DepositorTypeEmpty backboneUseRetroviralTagsAU1, FLAG, and OLLASExpressionMammalianPromoterhU6Available sinceJuly 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
Flowcode_09
Plasmid#231433PurposeEmpty backbone which expresses a unique 3 epitope tag on the histone H2bc3. This can be used for CRISPR knockdown of genes via ligation of gRNA oligos downstream of the U6 promoter. This plasmid is to be used with gRNAs.DepositorTypeEmpty backboneUseRetroviralTagsAU1, FLAG, and SExpressionMammalianPromoterhU6Available sinceJuly 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSDMA67
Plasmid#128356PurposegRNA ribozyme construct with Cryptococcus neoformans ACT1 promter and TRP1 terminator. Following ribozyme cleavage, a gRNA targeting ADE2 is liberated.DepositorInsertNoureothricin (NAT)
UseUnspecifiedPromoterACT1Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
S9_attL1-EGFP-C-term-attL2
Plasmid#128473PurposeEGFP entry cloneDepositorInsertEGFP entry clone
ExpressionBacterialAvailable sinceSept. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
S6_BstBI_SV40_SwaI
Plasmid#128470PurposeSV40 promoterDepositorInsertSV40 promoter
ExpressionBacterialAvailable sinceSept. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
S5_EcoRV_Ef1a_AscI
Plasmid#128469PurposeEf1a promoterDepositorInsertEf1a promoter
ExpressionBacterialAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
S12_EcoRV_PGK_AscI
Plasmid#128476PurposePGK promoterDepositorInsertPGK promoter
ExpressionBacterialAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
S8_attL1-N-term-EGFP-attL2
Plasmid#128472PurposeEGFP entry clonesDepositorInsertEGFP entry clones
ExpressionBacterialAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
S7_SwaI_Zeo_PacI
Plasmid#128471PurposeZeo Resistance geneDepositorInsertZeocin Resistance gene
ExpressionBacterialAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-VEGFR2#3 sgRNA Nestin-dCas9-KRAB-T2a-GFP
Plasmid#196990PurposeDerived from pLV hU6-sgRNA Nestin-dCas9-KRAB-T2a-GFP with KDR sgRNADepositorInsertVEGFR2
UseCRISPR and LentiviralAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only