We narrowed to 23,636 results for: promoter
-
Plasmid#125932PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB12Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ACE2 receptor 19-615
Plasmid#167012PurposeGateway-compatible Entry vector encoding ACE2 receptor (aa19-615) interacting with spike (S1) RBD domain from SARS-CoV-2DepositorAvailable SinceMarch 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
131_pAAV-ProB13-CatCh-GFP-WPRE
Plasmid#125933PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB13Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
55_pAAV-ProA13-CatCh-GFP-WPRE
Plasmid#125896PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA13Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
46_pAAV-ProC11-CatCh-GFP-WPRE
Plasmid#125946PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC11Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
11_pAAV-ProC6-CatCh-GFP-WPRE
Plasmid#125942PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC6Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
40_pAAV-ProC9-CatCh-GFP-WPRE
Plasmid#125944PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC9Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
95_pAAV-ProA28-CatCh-GFP-WPRE
Plasmid#125911PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA28Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
61_pAAV-ProA18-CatCh-GFP-WPRE
Plasmid#125901PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA18Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
5_pAAV-ProA9-CatCh-GFP-WPRE
Plasmid#125893PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA9Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
214_pAAV-ProD22-CatCh-GFP-WPRE
Plasmid#125998PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD22Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
159_pAAV-ProD3-CatCh-GFP-WPRE
Plasmid#125979PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD3Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-Nppa-Cre
Plasmid#247326PurposeExpresses Cre recombinase under the control of the Nppa Promoter.DepositorInsertNppa-Cre
UseAAVExpressionMammalianMutationTagRFP is out of frame and therefore not translat…PromoterNppa Proximal promoterAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-TRIP12-HECT
Plasmid#241818PurposeExpesses GST-TRIP12 for protein purificationDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-NRAS(G12D)-Neo
Plasmid#232953PurposeExpresses mutant form of NRASDepositorAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
sh2g-ZMYND8-human
Plasmid#201406PurposeKnockdown of Zinc Finger MYND Type-8. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertZMYND8 (ZMYND8 Human)
ExpressionMammalianAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12K317M
Plasmid#194164PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by tau cDNA exons 10-12 with FTLD-Tau K317M mutation. Expresses the tau circRNA 12-->10 K317M with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 WT (MAPT Human)
Tags3X FlagExpressionMammalianMutationChanged Lysine 317 to MethionineAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
IL2-AHA740D, E758K-2A-Cherry-RhoAQ63L in pmCherryN1
Plasmid#187288PurposeExpress pmCherry-IL2-AH A740D, E758K-2A-RhoA Q63LDepositorTagsmCherryExpressionMammalianMutationAH A740D, E758K, RhoA Q63LPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(SCA)-BPNLS(SV40)-P2A-EGFP (LTH1378)
Plasmid#185484PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(SCA) with an N-terminal NLS, C-terminal bi-partite NLS, and P2A-eGFPDepositorInserthuman codon usage NLS-anCas(SCA)-BPNLS-P2A-eGFP
UseIn vitro transcription; t7 promoterTagsBPNLS-P2A-eGFP and NLSExpressionMammalianPromoterCMV and T7Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only